BBa_K411125 1 BBa_K411125 eIF4A binding aptamer + terminator 2010-10-21T11:00:00Z 2015-05-08T01:12:25Z Cloning eIF4A Binding Aptamer (K411105) + Terminator (B0015) false true _526_ 0 6636 9 Not in stock false none. false Yong-Yu, Jhan component2092750 1 BBa_B0015 component2092743 1 BBa_K411105 annotation2092750 1 BBa_B0015 range2092750 1 69 197 annotation2092743 1 BBa_K411105 range2092743 1 1 60 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_K411192 1 BBa_K411192 Aptamer + Terminator 2010-10-21T11:00:00Z 2015-05-08T01:12:25Z true false _9_ 0 6638 9 Discontinued false false Geng Ming Su component2092537 1 BBa_K411105 component2092544 1 BBa_B0015 annotation2092544 1 BBa_B0015 range2092544 1 69 197 annotation2092537 1 BBa_K411105 range2092537 1 1 60 BBa_K411105 1 BBa_K411105 eIF4A binding aptamer 2010-10-21T11:00:00Z 2015-05-08T01:12:25Z no no false false _526_ 0 6638 9 Not in stock false no false Geng Ming Su annotation2094533 1 eIF4A binding aptamer range2094533 1 1 60 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K411192_sequence 1 acactcggaggacagcttagatgcaaagccggagtgagtgtacaccccgcgccaggggaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K411125_sequence 1 acactcggaggacagcttagatgcaaagccggagtgagtgtacaccccgcgccaggggaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K411105_sequence 1 acactcggaggacagcttagatgcaaagccggagtgagtgtacaccccgcgccaggggaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z