##gff-version 3
##sequence-region BBa_K411193 1 405
##sequence-region BBa_K411135 1 405
BBa_K411193	.	terminator	365	405	.	+	0	ID=BBa_B0012;Name=BBa_B0012
BBa_K411193	.	stem_loop	372	391	.	+	0	ID=annotation1686;Name=T7 TE;Parent=BBa_B0012
BBa_K411193	.	engineered_region	365	405	.	+	0	ID=annotation7020;Name=BBa_B0012;Parent=BBa_B0012
BBa_K411193	.	polyA_site	392	405	.	+	0	ID=annotation1690;Name=polya;Parent=BBa_B0012
BBa_K411193	.	stop_codon	398	398	.	+	0	ID=annotation1687;Name=stop;Parent=BBa_B0012
BBa_K411193	.	terminator	277	356	.	+	0	ID=BBa_B0010;Name=BBa_B0010
BBa_K411193	.	engineered_region	277	356	.	+	0	ID=annotation7018;Name=BBa_B0010;Parent=BBa_B0010
BBa_K411193	.	stem_loop	288	331	.	+	0	ID=annotation4184;Name=stem_loop;Parent=BBa_B0010
BBa_K411193	.	promoter	1	200	.	+	0	ID=BBa_R0010;Name=BBa_R0010
BBa_K411193	.	non_covalent_binding_site	89	126	.	+	0	ID=annotation1961223;Name=CAP binding site;Parent=BBa_R0010
BBa_K411193	.	CDS	1	88	.	+	0	ID=annotation1961221;Name=end of LacI coding region (inactive);Parent=BBa_R0010
BBa_K411193	.	promoter	161	166	.	+	0	ID=annotation1961225;Name=-10;Parent=BBa_R0010
BBa_K411193	.	non_covalent_binding_site	166	200	.	+	0	ID=annotation1961226;Name=LacI binding site;Parent=BBa_R0010
BBa_K411193	.	promoter	137	142	.	+	0	ID=annotation1961224;Name=-35;Parent=BBa_R0010
BBa_K411193	.	engineered_region	1	200	.	+	0	ID=annotation1961222;Name=BBa_R0010;Parent=BBa_R0010
BBa_K411193	.	start_codon	173	173	.	+	0	ID=annotation1961227;Name=start;Parent=BBa_R0010
BBa_K411193	.	mature_transcript_region	209	268	.	+	0	ID=BBa_K411105;Name=BBa_K411105
BBa_K411193	.	CDS	209	268	.	+	0	ID=annotation2094533;Name=eIF4A binding aptamer;Parent=BBa_K411105
BBa_K411135	.	terminator	277	405	.	+	0	ID=BBa_B0015;Name=BBa_B0015
BBa_K411135	.	terminator	277	356	.	+	0	ID=BBa_B0010;Name=BBa_B0010;Parent=BBa_B0015
BBa_K411135	.	engineered_region	277	356	.	+	0	ID=annotation7018;Name=BBa_B0010;Parent=BBa_B0010
BBa_K411135	.	stem_loop	288	331	.	+	0	ID=annotation4184;Name=stem_loop;Parent=BBa_B0010
BBa_K411135	.	terminator	365	405	.	+	0	ID=BBa_B0012;Name=BBa_B0012;Parent=BBa_B0015
BBa_K411135	.	stem_loop	372	391	.	+	0	ID=annotation1686;Name=T7 TE;Parent=BBa_B0012
BBa_K411135	.	engineered_region	365	405	.	+	0	ID=annotation7020;Name=BBa_B0012;Parent=BBa_B0012
BBa_K411135	.	polyA_site	392	405	.	+	0	ID=annotation1690;Name=polya;Parent=BBa_B0012
BBa_K411135	.	stop_codon	398	398	.	+	0	ID=annotation1687;Name=stop;Parent=BBa_B0012
BBa_K411135	.	mature_transcript_region	209	268	.	+	0	ID=BBa_K411105;Name=BBa_K411105
BBa_K411135	.	CDS	209	268	.	+	0	ID=annotation2094533;Name=eIF4A binding aptamer;Parent=BBa_K411105
BBa_K411135	.	promoter	1	200	.	+	0	ID=BBa_R0010;Name=BBa_R0010
BBa_K411135	.	non_covalent_binding_site	89	126	.	+	0	ID=annotation1961223;Name=CAP binding site;Parent=BBa_R0010
BBa_K411135	.	CDS	1	88	.	+	0	ID=annotation1961221;Name=end of LacI coding region (inactive);Parent=BBa_R0010
BBa_K411135	.	promoter	161	166	.	+	0	ID=annotation1961225;Name=-10;Parent=BBa_R0010
BBa_K411135	.	non_covalent_binding_site	166	200	.	+	0	ID=annotation1961226;Name=LacI binding site;Parent=BBa_R0010
BBa_K411135	.	promoter	137	142	.	+	0	ID=annotation1961224;Name=-35;Parent=BBa_R0010
BBa_K411135	.	engineered_region	1	200	.	+	0	ID=annotation1961222;Name=BBa_R0010;Parent=BBa_R0010
BBa_K411135	.	start_codon	173	173	.	+	0	ID=annotation1961227;Name=start;Parent=BBa_R0010
>BBa_K411193
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagc
gggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggct
cgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagacactcggaggacagcttagatgcaaagc
cggagtgagtgtacaccccgcgccaggggaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactg
ggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttc
tgcgtttata
>BBa_K411135
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagc
gggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggct
cgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagacactcggaggacagcttagatgcaaagc
cggagtgagtgtacaccccgcgccaggggaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactg
ggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttc
tgcgtttata