BBa_K412000 1 BBa_K412000 PyeaR+GFP 2010-10-14T11:00:00Z 2015-05-08T01:12:26Z We got both subparts from the registry, when we looked for a nitrate detector and a reporter. PyeaR+GFP is a nitrate/nitrite detector. PyeaR (BBa_K216005) is a nitrate/nitrite inducible promoter, that we ligated to GFP (I13504), so that we could detect nitrates and nitrites. false false _529_ 0 7067 9 It's complicated true We knew we wanted a nitrate sensitive promoter followed by a reporter. Therefore we digested PyeaR with SpeI and PstI and digested GFP with XbaI and PstI and then ligated the two parts together to form this composite part. false Kristina Ehrhardt component2086669 1 BBa_B0012 component2086662 1 BBa_K216005 component2086666 1 BBa_E0040 component2086664 1 BBa_B0034 component2086667 1 BBa_B0010 annotation2086669 1 BBa_B0012 range2086669 1 943 983 annotation2086666 1 BBa_E0040 range2086666 1 127 846 annotation2086664 1 BBa_B0034 range2086664 1 109 120 annotation2086667 1 BBa_B0010 range2086667 1 855 934 annotation2086662 1 BBa_K216005 range2086662 1 1 100 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K216005 1 BBa_K216005 PyeaR promoter, responsive to nitrate, nitrite and nitric oxide 2009-09-24T11:00:00Z 2015-05-08T01:11:30Z BioBricked from E. coli K-12 genomic DNA by the Edinburgh 2009 iGEM team. PyeaR promoter. This is the promoter of the Escherichia coli yeaR/yoaG operon (see Lin, H.-Y., Bledsoe, P.J., and Stewart, V. 2007. Activation of yeaR-yoaG operon transcription by the nitrate-responsive regulator NarL is independent of oxygen-responsive regulator Fnr in ''Escherichia coli'' K-12. J. Bacteriol. 189, 7539-7548). Unlike other E. coli promoters responding to nitrate and nitrite, this promoter is not repressed under aerobic conditions. false false _317_ 0 837 163 It's complicated true No special considerations. false Edinburgh iGEM 2009 annotation2027072 1 NarL-binding region range2027072 1 50 65 annotation2027075 1 promoter -10 region range2027075 1 89 94 annotation2027074 1 promoter -35 region range2027074 1 66 71 annotation2027073 1 NsrR-binding region range2027073 1 58 80 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K412000_sequence 1 ttcccatctataatcctccctgattcttcgctgatatggtgctaaaaagtaaccaataaatggtatttaaaatgcaaattatcaggcgtaccctgaaacgtactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K216005_sequence 1 ttcccatctataatcctccctgattcttcgctgatatggtgctaaaaagtaaccaataaatggtatttaaaatgcaaattatcaggcgtaccctgaaacg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z