BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_K093005 1 RBS-RFP RFP with RBS 2008-10-27T12:00:00Z 2015-05-08T01:08:40Z registry plasmids Released HQ 2013 RFP, BBa_E1010, with Elowitz RBS, BBa_B0034. false false _247_ 0 3630 9 In stock false The part was needed for downstream applications. There can be no expression of a reporter without a ribosome binding site. true Kathy Lam, Danielle Nash component2244025 1 BBa_E1010 component2244022 1 BBa_B0034 annotation2244022 1 BBa_B0034 range2244022 1 1 12 annotation2244025 1 BBa_E1010 range2244025 1 19 724 BBa_K216005 1 BBa_K216005 PyeaR promoter, responsive to nitrate, nitrite and nitric oxide 2009-09-24T11:00:00Z 2015-05-08T01:11:30Z BioBricked from E. coli K-12 genomic DNA by the Edinburgh 2009 iGEM team. PyeaR promoter. This is the promoter of the Escherichia coli yeaR/yoaG operon (see Lin, H.-Y., Bledsoe, P.J., and Stewart, V. 2007. Activation of yeaR-yoaG operon transcription by the nitrate-responsive regulator NarL is independent of oxygen-responsive regulator Fnr in ''Escherichia coli'' K-12. J. Bacteriol. 189, 7539-7548). Unlike other E. coli promoters responding to nitrate and nitrite, this promoter is not repressed under aerobic conditions. false false _317_ 0 837 163 It's complicated true No special considerations. false Edinburgh iGEM 2009 annotation2027074 1 promoter -35 region range2027074 1 66 71 annotation2027073 1 NsrR-binding region range2027073 1 58 80 annotation2027075 1 promoter -10 region range2027075 1 89 94 annotation2027072 1 NarL-binding region range2027072 1 50 65 BBa_K412001 1 BBa_K412001 PyeaR+RFP 2010-10-14T11:00:00Z 2015-05-08T01:12:26Z We got both subparts from the registry, when we looked for a nitrate detector and a reporter. PyeaR+RFP is a nitrate/nitrite detector. PyeaR (BBa_K216005) is a nitrate/nitrite inducible promoter, that we ligated to RFP (K093005), so that we could detect nitrates and nitrites. false false _529_ 0 7067 9 It's complicated true We knew we wanted a nitrate sensitive promoter followed by a reporter to work in E.coli. Therefore we digested PyeaR with SpeI and PstI and digested RFP with XbaI and PstI and then ligated the two parts together to form this composite part. false Kristina Ehrhardt component2247557 1 BBa_K216005 component2247563 1 BBa_K093005 annotation2247557 1 BBa_K216005 range2247557 1 1 100 annotation2247563 1 BBa_K093005 range2247563 1 109 832 BBa_K093005_sequence 1 aaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_B0034_sequence 1 aaagaggagaaa BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K216005_sequence 1 ttcccatctataatcctccctgattcttcgctgatatggtgctaaaaagtaaccaataaatggtatttaaaatgcaaattatcaggcgtaccctgaaacg BBa_K412001_sequence 1 ttcccatctataatcctccctgattcttcgctgatatggtgctaaaaagtaaccaataaatggtatttaaaatgcaaattatcaggcgtaccctgaaacgtactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z