BBa_K414003 1 BBa_K414003 Strong Plant RBS (Kozak sequence) + mCherry from J06504 2010-09-27T11:00:00Z 2015-05-08T01:12:26Z The source of mCherry was derived using modified primers containing the Kozak sequence designed to bind to the iGEM part BBa_J06702 (Wang,2005) In order for mCherry Fluorescent Protein to function properly in plants, a plant-specific ribosome binding site (Kozak sequence)must be added to the 5'region just upstream from the start of translation.The Kozak sequence is AAA AAA AAA ACA and is directly adjacent to the ATG start codon in mCherry. One point mutation that should be noted is nucleotide 483 of J06504 (mCherry). C -> T is the mutation, but examining the translation of the sequence in the proper reading frame yields no translational discrepancies. Also, no illegal iGEM restriction sites were generated from the point mutation. false false _534_ 0 7418 9 It's complicated false One consideration we made was the strength of the RBS we wanted upstream of the reporter. Evidence can be found in the literature that a spectrum of translational activity can be generated by tampering with the Kozak sequence in plants. Future teams may wish to investigate how they can tamper with their Kozak of designing a system that requires discrete but relative expression of genes initiated by the same promoters. false Matthew Polasko annotation2080977 1 Translational Start range2080977 1 19 19 annotation2080979 1 Translational Stop 2x range2080979 1 727 727 annotation2080978 1 mCherry (J06504) range2080978 1 19 726 annotation2080976 1 Kpn I range2080976 1 1 6 annotation2080980 1 C -> T range2080980 1 501 501 annotation2080975 1 Kozak range2080975 1 7 18 BBa_K414003_sequence 1 ggtaccaaaaaaaaaacaatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgctctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z