BBa_K414004 1 BBa_K414004 Strong Plant RBS (Kozak sequence) + EYFP from E0030 2010-09-27T11:00:00Z 2015-05-08T01:12:26Z The source of EYFP was derived using modified primers containing the Kozak sequence designed to bind to the iGEM part BBa_E0430 (Conboy,2004) In order for Enhanced Yellow Fluorescent Protein (EYFP)to function properly in plants, a plant-specific ribosome binding site (Kozak sequence)must be added to the 5'region just upstream from the start of translation.The Kozak sequence is AAA AAA AAA ACA and is directly adjacent to the ATG start codon in EYFP. false false _534_ 0 7418 9 It's complicated false One consideration we made was the strength of the RBS we wanted upstream of the reporter. Evidence can be found in the literature that a spectrum of translational activity can be generated by tampering with the Kozak sequence in plants. Future teams may wish to investigate how they can tamper with their Kozak of designing a system that requires discrete but relative expression of genes initiated by the same promoters. false Matthew Polasko annotation2081033 1 Kpn I range2081033 1 1 6 annotation2081034 1 Translational Start range2081034 1 19 19 annotation2081036 1 Translational Stop 2x range2081036 1 736 736 annotation2081035 1 EYFP (E0030) range2081035 1 19 735 annotation2081032 1 Kozak range2081032 1 7 18 BBa_K414004_sequence 1 ggtaccaaaaaaaaaacaatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z