BBa_K414007 1 BBa_K414007 DREB1C promoter 2010-10-18T11:00:00Z 2015-05-08T01:12:26Z Arabidopsis Genome PCR product from Dr Harper Lab. The DREB1C Promoter is a cold stress induced promoter from Arabidopsis that is up regulated during non-freezing cold stress (multiple transcription factors including MYC and CAMTA3) and down regulated by circadian controls (PIF7). Evidence that it shares expression orthologs in some plants hints that the DREB1C promoter could be adapted for use in many plant types. (Yamaguchi-Shinozaki, 2009)(Shinozaki, 1998). false false _534_ 0 6974 9 It's complicated true DREB1C was derived from the region 500 bp up stream of the DREB1C start codon. The first 59 bps were omitted due to an Xba1 site in this region. Extensive research shows no expression relevance to this region. (Shinozaki, 1998) false Christian Copley annotation2090369 1 DREB1C range2090369 1 1 463 BBa_K414007_sequence 1 agtatttgcaatgcacgatatgtgaatggagaaaagacagaaagagcatttgaaaatatctcgtttcacggatcattatgtctaattattttaccatagaaaagcgacaattataaacaatttgttattcgtggaaaaataatatttaataatggttgtcgtaccctataaactacagccacacattcatacaataagaagttaaaaaaattcataccctaaaggcatcaaccagtgaagggtcagaaacttcccaagatgggtcaaaggacacatgtcagattctcagtgattgacagccttgataattacaaaaccgtgggatcgcttagctgtttcttatccacgtggcattcacagagacagaaactccgcgttcgaccccacaaatatccaaacatcttccggccaatataaacagcaagctctcactccaacatttctataacttcaaacggtacct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z