BBa_K414008 1 BBa_K414008 rd29A Promoter 2010-10-25T11:00:00Z 2015-05-08T01:12:26Z This promoter came from the synthetic design that contained the rd29A Promoter + Strong Plant Kozak (RBS) + RFP in the pMA vector. rd29A promoter is regulated by cold stress responses, salinity and drought by using alternative ABA independent and dependent transcription factors. From previous studies, the rd29A promoter not only increases the resistance to different stresses in plants, but it also minimizes the negative effects such as dwarfism (only 30% grown reduction compared to the wild type plant and only a slight growth retardation phenotype on the tobacco plant ) in comparison to the 78% growth reduction of the 35S promoter. This proved that the rd29A is a better promoter than the 35S when used with a stress reporter. Another study also showed that the survival rates of the transgenic clones (with the rd29A promoter) had a greater probability of survival after recovery from exposure to freezing temperatures. This was compared to the non-transgenic cells that showed damage to the plant with no recovery after freezing. Therefore, the rd29A promoter is critically important for it can potentially improve agricultural techniques that farmers can use for their crops. false false _534_ 0 6837 9 It's complicated false The rd29A promoter was isolated by the use of the rd29A designed primers in PCR. This was blunt end Topo cloned, digested with EcoR 1 and Pst 1 sites, and was then ligated to the pSB1C3 vector. false Elaine Bersaba annotation2102160 1 rd29A range2102160 1 1 836 BBa_K414008_sequence 1 aggtagaacttatatacattatattgtaattttttgtaacaaaatgtttttattattattatagaattttactggttaaattaaaaatgaatagaaaaggtgaattaagaggagagaggaggtaaacattttcttctattttttcatattttcaggataaattattgtaaaagtttacaagatttccatttgactagggtaaatgaggaatattctctagtaagatcattatttcatctacttcttttatcttctaccagtagaggaataaacaatatttagctcctttgtaaatacaaattaattttccttcttgacatcattcaattttaattttacgtataaaataaaagatcatacctattagaacgattaaggagaaatacaattcgaatgagaaggatgtgccgtttgttataataaacagccacacgacgtaaacgtaaaatgaccacatgatgggccaatagacatggaccgactactaataatagtaagttacattttaggatggaataaatatcataccgacatcagttttgaaagaaaagggaaaaaaagaaaaaataaataaaagatatactaccgacatgagttccaaaaagcaaaaaaaaagatcaagccgacacagacacgcgtagagagcaaaatgactttgacgtcacaccacgaaaacagacgcttcatacgtgtccctttatctctctcagtctctctataaacttagtgagaccctcctctgttttactcacaaatatgcaaactagaaaacaatcatcaggaataaagggtttgattacttctattggaaagaaaaaaatctttggaaaatggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z