BBa_K415000 1 BBa_K415000 pLux/cI-OR : RBS-mCherry : Term 2010-06-06T11:00:00Z 2015-05-08T01:12:26Z http://partsregistry.org/wiki/index.php?title=Part:BBa_R0065 http://partsregistry.org/wiki/index.php?title=Part:BBa_J06702 This is a BioBrick composed of parts BBa_R0065 and BBa_J06702. This composite produces the mCherry fluorescent protein. It is activated by the presence of LuxR and AHL, and it is repressed by cI. false false _525_ 0 6719 9 It's complicated false No design considerations to note. false Grant Robinson, Andrew Yang component2070311 1 BBa_B0034 component2070314 1 BBa_J06504 component2070317 1 BBa_B0012 component2070302 1 BBa_R0065 component2070315 1 BBa_B0010 annotation2070315 1 BBa_B0010 range2070315 1 846 925 annotation2070314 1 BBa_J06504 range2070314 1 124 837 annotation2070317 1 BBa_B0012 range2070317 1 934 974 annotation2070311 1 BBa_B0034 range2070311 1 106 117 annotation2070302 1 BBa_R0065 range2070302 1 1 97 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_J06504 1 mCherry monomeric RFP optimized for bacteria 2005-07-17T11:00:00Z 2016-01-25T01:05:28Z mCherry from Roger Y. Tsien's lab, altered to be BioBrick compatible Released HQ 2013 mRFP (DsRed) derived, altered to be a biobrick by removing a PstI site and adding in the ends. false false _20_ 4206 340 20 In stock false <p> Made a point mutation to eliminate a PstI site in the middle and then added BioBrick ends using PCR. </p> <p> Sequenced using primers that bind to the pSB1A2 plasmid on either side of the brick. </p> true ytwang annotation1585829 1 mCherry range1585829 1 1 711 annotation1585833 1 C->T (removing PstI site) range1585833 1 352 352 BBa_R0065 1 cI+luxR Promoter (lambda cI and luxR regulated -- hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z Released HQ 2013 cI repressor negatively regulates this promoter and LuxR activates its transcription.The effect of cI is dominant over LuxR. This part is based on the LuxR and cI repressor regulated hybrid promoter designed and tested by Ron Weiss. It requires the binding of two cI repressor dimers for maximal repression and contains two cI repressor binding sites namely, OR1 and OR2. This promoter is leaky in the sense that 'some' transcription is seen in the absence of both cI and LuxR. </P> <P>&nbsp;</P> <table width="75%" border="1"> <tr> <td><strong>LuxI</strong></td> <td><strong>cI</strong></td> <td><strong>activity of promoter</strong></td> </tr> <tr> <td>+</td> <td>+</td> <td>zero</td> </tr> <tr> <td>+</td> <td>-</td> <td>maximum</td> </tr> <tr> <td>-</td> <td>+</td> <td>zero</td> </tr> <tr> <td>-</td> <td>-</td> <td>leaky (no quantitative information)</td> </tr> </table> <P>&nbsp;</P> false false _1_ 0 24 7 In stock false <P> <P>This part was designed based on the LuxR and cI repressor regulated hybrid promoter tested by Ron Weiss and the LuxR-LuxICDABE sequence annotated by Tom Knight <genbank>AF170104</genbank>. <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation1986779 1 -35 range1986779 1 71 76 annotation1986778 1 lux p(R) start range1986778 1 58 58 annotation1986776 1 -10 range1986776 1 47 52 annotation1986777 1 OR2 cI range1986777 1 57 73 annotation1986780 1 OR1 cI range1986780 1 81 97 annotation1986775 1 Lux Box range1986775 1 6 25 annotation1986774 1 BBa_R0065 range1986774 1 1 97 annotation1986781 1 -10 range1986781 1 94 97 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K415000_sequence 1 taagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataacaccgtgcgtgttgactattttacctctggcggtgatatactagagaaagaggagaaatactagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_J06504_sequence 1 atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa BBa_R0065_sequence 1 taagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataacaccgtgcgtgttgactattttacctctggcggtgata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z