BBa_J06504 1 mCherry monomeric RFP optimized for bacteria 2005-07-17T11:00:00Z 2016-01-25T01:05:28Z mCherry from Roger Y. Tsien's lab, altered to be BioBrick compatible Released HQ 2013 mRFP (DsRed) derived, altered to be a biobrick by removing a PstI site and adding in the ends. false false _20_ 4206 340 20 In stock false <p> Made a point mutation to eliminate a PstI site in the middle and then added BioBrick ends using PCR. </p> <p> Sequenced using primers that bind to the pSB1A2 plasmid on either side of the brick. </p> true ytwang annotation1585829 1 mCherry range1585829 1 1 711 annotation1585833 1 C->T (removing PstI site) range1585833 1 352 352 BBa_K415000 1 BBa_K415000 pLux/cI-OR : RBS-mCherry : Term 2010-06-06T11:00:00Z 2015-05-08T01:12:26Z http://partsregistry.org/wiki/index.php?title=Part:BBa_R0065 http://partsregistry.org/wiki/index.php?title=Part:BBa_J06702 This is a BioBrick composed of parts BBa_R0065 and BBa_J06702. This composite produces the mCherry fluorescent protein. It is activated by the presence of LuxR and AHL, and it is repressed by cI. false false _525_ 0 6719 9 It's complicated false No design considerations to note. false Grant Robinson, Andrew Yang component2070311 1 BBa_B0034 component2070314 1 BBa_J06504 component2070317 1 BBa_B0012 component2070302 1 BBa_R0065 component2070315 1 BBa_B0010 annotation2070311 1 BBa_B0034 range2070311 1 106 117 annotation2070315 1 BBa_B0010 range2070315 1 846 925 annotation2070317 1 BBa_B0012 range2070317 1 934 974 annotation2070302 1 BBa_R0065 range2070302 1 1 97 annotation2070314 1 BBa_J06504 range2070314 1 124 837 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_R0065 1 cI+luxR Promoter (lambda cI and luxR regulated -- hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z Released HQ 2013 cI repressor negatively regulates this promoter and LuxR activates its transcription.The effect of cI is dominant over LuxR. This part is based on the LuxR and cI repressor regulated hybrid promoter designed and tested by Ron Weiss. It requires the binding of two cI repressor dimers for maximal repression and contains two cI repressor binding sites namely, OR1 and OR2. This promoter is leaky in the sense that 'some' transcription is seen in the absence of both cI and LuxR. </P> <P>&nbsp;</P> <table width="75%" border="1"> <tr> <td><strong>LuxI</strong></td> <td><strong>cI</strong></td> <td><strong>activity of promoter</strong></td> </tr> <tr> <td>+</td> <td>+</td> <td>zero</td> </tr> <tr> <td>+</td> <td>-</td> <td>maximum</td> </tr> <tr> <td>-</td> <td>+</td> <td>zero</td> </tr> <tr> <td>-</td> <td>-</td> <td>leaky (no quantitative information)</td> </tr> </table> <P>&nbsp;</P> false false _1_ 0 24 7 In stock false <P> <P>This part was designed based on the LuxR and cI repressor regulated hybrid promoter tested by Ron Weiss and the LuxR-LuxICDABE sequence annotated by Tom Knight <genbank>AF170104</genbank>. <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation1986779 1 -35 range1986779 1 71 76 annotation1986781 1 -10 range1986781 1 94 97 annotation1986775 1 Lux Box range1986775 1 6 25 annotation1986774 1 BBa_R0065 range1986774 1 1 97 annotation1986777 1 OR2 cI range1986777 1 57 73 annotation1986780 1 OR1 cI range1986780 1 81 97 annotation1986778 1 lux p(R) start range1986778 1 58 58 annotation1986776 1 -10 range1986776 1 47 52 BBa_K415009 1 BBa_K415009 pLux/cI-OR : RBS-mCherry : Term : P(tetR) : RBS-luxR : Term : pLux 2010-06-17T11:00:00Z 2015-05-08T01:12:26Z composite of BBa_K415000 and BBa_F2620 This composite is composed of the parts BBa_K415000 and BBa_F2620. It can produce both luxR and mCherry. The production of luxR is repressed by aTc. The production of mCherry is activated by c6-AHL and luxR, and repressed by cI. false false _525_ 0 6739 9 Not in stock false No considerations to note. false Crystal McKenzie component2294852 1 BBa_K415000 component2294878 1 BBa_F2620 annotation2294878 1 BBa_F2620 range2294878 1 983 2043 annotation2294852 1 BBa_K415000 range2294852 1 1 974 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_F2620 1 BBa_F2620 3OC₆HSL -> PoPS Receiver 2004-08-08T11:00:00Z 2015-08-31T04:07:27Z Formerly I13270 Released HQ 2013 This device senses the 3OC₆HSL concentration in the media and produces output PoPS according to the transfer function given below. LuxR production is controlled by the tet repressible R0040. Initial characterization work has been done on this device using I13273 as a test device. false true _101_6_ 0 135 6 In stock false <a href="http://model.mit.edu/endipedia/index.php?title=Reciever_Definition#Data_Sheets">Example Data Sheets for F2620</a> true Barry Canton [bcanton@mit.edu] and Anna Labno [labnoa@mit.edu] component2259910 1 BBa_R0062 component2259908 1 BBa_B0015 component2259889 1 BBa_R0040 component2259898 1 BBa_C0062 component2259895 1 BBa_B0034 annotation2259895 1 BBa_B0034 range2259895 1 63 74 annotation2259908 1 BBa_B0015 range2259908 1 870 998 annotation2259889 1 BBa_R0040 range2259889 1 1 54 annotation2259910 1 BBa_R0062 range2259910 1 1007 1061 annotation2259898 1 BBa_C0062 range2259898 1 81 836 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 BBa_C0062 1 luxr luxR repressor/activator, (no LVA?) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 In complex with HSL, LuxR binds to the Lux promoter, activating transcription from Pr <bb_part>BBa_R0062</bb_part>, and repressing transcription from Pl <bb_part>BBa_R0063</bb_part>. <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux activator, LuxR complexed to HSL. Two molecules of LuxR protein form a complex with two molecules the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false true _1_ 0 24 7 In stock false <P> <P>2 silent point mutants were introduced in the coding sequence to remove internal XbaI and PstI sites. Mutation sites were chosen to replace codons commonly used in <em>E. coli</em> with codons used at a similar frequency. <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation7039 1 BBa_C0062 range7039 1 1 756 annotation1766 1 luxR range1766 1 1 750 annotation1764 1 T range1764 1 174 174 annotation1762 1 prefix range1762 1 1 2 annotation2213986 1 Help:Barcodes range2213986 1 757 781 annotation1765 1 A range1765 1 492 492 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_R0062 1 lux pR Promoter (luxR & HSL regulated -- lux pR) 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <em>V. fischeri</em> Released HQ 2013 Promoter activated by LuxR in concert with HSL</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the LuxR activator protein complexed with the autoinducer, 3-oxo-hexanoyl-HSL. Two molecules of LuxR protein form a complex with two molecules of the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription. false true _1_ 0 24 7 In stock false <P> <P>This promoter is based on the <em>Vibrio fischeri </em>quorum sensing gene promoters. Two genes LuxI and LuxR and transcribed in opposite directions as shown below. The original sequence from which the parts <bb_part>BBa_R0062</bb_part> and <bb_part>BBa_R0063</bb_part> were derived is shown in the picture below. <p><img src="<bb_file>Image1.gif</bb_file>" width="614" height="362"><P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation2047 1 -10 range2047 1 42 47 annotation2046 1 -35 range2046 1 20 25 annotation7070 1 BBa_R0062 range7070 1 1 55 annotation2048 1 start range2048 1 53 53 annotation2045 1 LuxR/HSL range2045 1 1 20 BBa_K415000_sequence 1 taagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataacaccgtgcgtgttgactattttacctctggcggtgatatactagagaaagaggagaaatactagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0062_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_B0034_sequence 1 aaagaggagaaa BBa_J06504_sequence 1 atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K415009_sequence 1 taagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataacaccgtgcgtgttgactattttacctctggcggtgatatactagagaaagaggagaaatactagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_R0065_sequence 1 taagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataacaccgtgcgtgttgactattttacctctggcggtgata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_C0062_sequence 1 atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_F2620_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z