BBa_K415100 1 BBa_K415100 RBS : pVIII 2010-06-25T11:00:00Z 2015-05-08T01:12:27Z This ~300 bp part was produced via PCR from the genome of bacteriophage M13X07. The primers read as follows: Forward: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGaaagaggagaaatactagATGAAAAAGTCTTTAGTCCTCAAAGCCTC Reverse: [To be specified] These primers ensured that the PCR included the standard BioBrick restriction sites. A copy of pVIII, a surface protein that is highly expressed by bacteriophage M13. This part has applications in phage display. false false _525_ 0 6719 9 In stock false This sequence was produced via PCR, and it was determined after a graded PCR experiment that the optimal ligation temperature for pVIII was 60 degrees Celsius. false Grant Robinson annotation2072815 1 pVIII range2072815 1 19 240 annotation2072814 1 B0034 Strong RBS range2072814 1 1 12 BBa_K415100_sequence 1 aaagaggagaaatactagatgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z