BBa_R0065 1 cI+luxR Promoter (lambda cI and luxR regulated -- hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z Released HQ 2013 cI repressor negatively regulates this promoter and LuxR activates its transcription.The effect of cI is dominant over LuxR. This part is based on the LuxR and cI repressor regulated hybrid promoter designed and tested by Ron Weiss. It requires the binding of two cI repressor dimers for maximal repression and contains two cI repressor binding sites namely, OR1 and OR2. This promoter is leaky in the sense that 'some' transcription is seen in the absence of both cI and LuxR. </P> <P>&nbsp;</P> <table width="75%" border="1"> <tr> <td><strong>LuxI</strong></td> <td><strong>cI</strong></td> <td><strong>activity of promoter</strong></td> </tr> <tr> <td>+</td> <td>+</td> <td>zero</td> </tr> <tr> <td>+</td> <td>-</td> <td>maximum</td> </tr> <tr> <td>-</td> <td>+</td> <td>zero</td> </tr> <tr> <td>-</td> <td>-</td> <td>leaky (no quantitative information)</td> </tr> </table> <P>&nbsp;</P> false false _1_ 0 24 7 In stock false <P> <P>This part was designed based on the LuxR and cI repressor regulated hybrid promoter tested by Ron Weiss and the LuxR-LuxICDABE sequence annotated by Tom Knight <genbank>AF170104</genbank>. <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation1986779 1 -35 range1986779 1 71 76 annotation1986774 1 BBa_R0065 range1986774 1 1 97 annotation1986778 1 lux p(R) start range1986778 1 58 58 annotation1986776 1 -10 range1986776 1 47 52 annotation1986777 1 OR2 cI range1986777 1 57 73 annotation1986781 1 -10 range1986781 1 94 97 annotation1986780 1 OR1 cI range1986780 1 81 97 annotation1986775 1 Lux Box range1986775 1 6 25 BBa_K415100 1 BBa_K415100 RBS : pVIII 2010-06-25T11:00:00Z 2015-05-08T01:12:27Z This ~300 bp part was produced via PCR from the genome of bacteriophage M13X07. The primers read as follows: Forward: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGaaagaggagaaatactagATGAAAAAGTCTTTAGTCCTCAAAGCCTC Reverse: [To be specified] These primers ensured that the PCR included the standard BioBrick restriction sites. A copy of pVIII, a surface protein that is highly expressed by bacteriophage M13. This part has applications in phage display. false false _525_ 0 6719 9 In stock false This sequence was produced via PCR, and it was determined after a graded PCR experiment that the optimal ligation temperature for pVIII was 60 degrees Celsius. false Grant Robinson annotation2072815 1 pVIII range2072815 1 19 240 annotation2072814 1 B0034 Strong RBS range2072814 1 1 12 BBa_K415109 1 BBa_K415109 PLuxR/cI-OR : RBS : pVIII 2010-07-03T11:00:00Z 2015-05-08T01:12:27Z The promoter portion is part BBa_R0065; the ribosome binding site and gene portion is part BBa_K415100. This is a composite part including a copy of the surface protein pIII downstream of a promoter repressed by cI and activated by the LuxR-3OC6HSL complex; this part therefore requires either LuxI or external 3OC6HSL to function. This part has applications in inducible phage display. false false _525_ 0 6719 9 Not in stock false There are no specific design considerations to be noted. false Grant Robinson component2218814 1 BBa_K415100 component2218804 1 BBa_R0065 annotation2218814 1 BBa_K415100 range2218814 1 106 345 annotation2218804 1 BBa_R0065 range2218804 1 1 97 BBa_K415100_sequence 1 aaagaggagaaatactagatgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctga BBa_K415109_sequence 1 taagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataacaccgtgcgtgttgactattttacctctggcggtgatatactagagaaagaggagaaatactagatgaaaaagtctttagtcctcaaagcctctgtagccgttgctaccctcgttccgatgctgtctttcgctgctgagggtgacgatcccgcaaaagcggcctttaactccctgcaagcctcagcgaccgaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctga BBa_R0065_sequence 1 taagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataacaccgtgcgtgttgactattttacctctggcggtgata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z