BBa_K415116 1 BBa_K415116 RBS : pIX 2010-07-05T11:00:00Z 2015-05-08T01:12:27Z This part originates in bacteriophage M13X07, specifically the 99 base-pair sequence for gIX and a weak ribosome binding site [To be specified]. A copy of pIX, an end surface protein that is expressed by bacteriophage M13. pIX is also involved with initiation of M13 assembly. This part has applications in phage display. false false _525_ 0 6719 9 Not in stock false This ~300 bp part was produced via PCR from the genome of bacteriophage M13X07. The primers read as follows: Forward: [To be specified] Reverse: [To be specified] These primers ensured that the PCR included the standard BioBrick restriction sites. false Grant Robinson BBa_K415116_sequence 1 atgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgtttaatggaaacttcctcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z