BBa_K415120 1 BBa_K415120 p8-Fos fusion 2010-10-23T11:00:00Z 2015-05-08T01:12:27Z later M13 p8 gene optimized for phage display fused to the Fos leucine zipper. Includes a leader sequence and a Myc tag. false false _525_ 0 6886 9 Not in stock false later false Jason Stevens BBa_K415141 1 BBa_K415141 RBS + M13 p8-Fos fusion 2010-10-23T11:00:00Z 2015-05-08T01:12:27Z to be done RBS and a leuzine-zipper/M13 p8 fusion. It's meant to allow for the p8-fusion protein to become incorporated into the M13 phage coat. false false _525_ 0 6886 9 Not in stock false to be done false Jason Stevens component2095525 1 BBa_B0034 component2095526 1 BBa_K415120 annotation2095525 1 BBa_B0034 range2095525 1 1 12 annotation2095526 1 BBa_K415120 range2095526 1 19 444 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0034_sequence 1 aaagaggagaaa BBa_K415141_sequence 1 aaagaggagaaatactagatgaaaaagtctttagtcctcaaagcttctgtagccgttgctaccctcgttccgatgctgtctttcgctctgaccgacaccctgcaagctgaaaccgaccagctggaagacgaaaaatctgctctgcaaaccgaaatcgctaacctgctgaaagaaaaagaaaaactggaatttatcctggctgctcacgcagccgcggaacaaaaactcatctcagaagaggatctgcgcgccgaccacggcagccgcgccagccacgacgccagccggcgcgctgagggtgacgatcccgcaaaagcggcctacgagactatcaaagacgacatcgttaaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctga BBa_K415120_sequence 1 atgaaaaagtctttagtcctcaaagcttctgtagccgttgctaccctcgttccgatgctgtctttcgctctgaccgacaccctgcaagctgaaaccgaccagctggaagacgaaaaatctgctctgcaaaccgaaatcgctaacctgctgaaagaaaaagaaaaactggaatttatcctggctgctcacgcagccgcggaacaaaaactcatctcagaagaggatctgcgcgccgaccacggcagccgcgccagccacgacgccagccggcgcgctgagggtgacgatcccgcaaaagcggcctacgagactatcaaagacgacatcgttaaatatatcggttatgcgtgggcgatggttgttgtcattgtcggcgcaactatcggtatcaagctgtttaagaaattcacctcgaaagcaagctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z