BBa_K415200 1 BBa_K415200 Strong Constitutive T5 Promoter with cmt Operator (T5-cmt) 2010-08-19T11:00:00Z 2015-05-08T01:12:27Z This part was synthesized via minigene construction by Mr. Gene; its source is the 2010 paper by Choi, et al., titled, "A novel, versatile, and tightly regulated expression system for E. Coli strains." This is a strong, constitutive partial T5 promoter with the cmt operator appended immediately afterward. This construct was specified in a recent (as of 2010) paper by Choi, et al., titled, "A novel, versatile, and tightly regulated expression system for E. Coli strains." In the absence of cymR, this promoter should function as a strong, constitutive promoter; in the presence of cymR, this promoter should be repressed with essentially zero leaky transcription. true false _525_ 0 6719 9 Discontinued false This promoter contains the T5 partial promoter, the sequence of which was derived from the 2010 Choi, et al. paper. Like T7 bacteriophage promoters, this T5 promoter is constitutive and strong; unlike T7 promoters, however, it does not require T7 RNA Polymerase. This means that the T5 promoter could have wide applicability as a strong promoter in Escherichia coli and other organisms. false Grant Robinson annotation2078428 1 cmt Operator range2078428 1 54 85 annotation2078429 1 T5 Partial Promoter range2078429 1 1 53 BBa_K415200_sequence 1 aaatcataaaaaatttatttgctttgtgagcggataacaattataatagattcaacaaacagacaatctggtctgtttgtattat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z