BBa_K415200 1 BBa_K415200 Strong Constitutive T5 Promoter with cmt Operator (T5-cmt) 2010-08-19T11:00:00Z 2015-05-08T01:12:27Z This part was synthesized via minigene construction by Mr. Gene; its source is the 2010 paper by Choi, et al., titled, "A novel, versatile, and tightly regulated expression system for E. Coli strains." This is a strong, constitutive partial T5 promoter with the cmt operator appended immediately afterward. This construct was specified in a recent (as of 2010) paper by Choi, et al., titled, "A novel, versatile, and tightly regulated expression system for E. Coli strains." In the absence of cymR, this promoter should function as a strong, constitutive promoter; in the presence of cymR, this promoter should be repressed with essentially zero leaky transcription. true false _525_ 0 6719 9 Discontinued false This promoter contains the T5 partial promoter, the sequence of which was derived from the 2010 Choi, et al. paper. Like T7 bacteriophage promoters, this T5 promoter is constitutive and strong; unlike T7 promoters, however, it does not require T7 RNA Polymerase. This means that the T5 promoter could have wide applicability as a strong promoter in Escherichia coli and other organisms. false Grant Robinson annotation2078428 1 cmt Operator range2078428 1 54 85 annotation2078429 1 T5 Partial Promoter range2078429 1 1 53 BBa_K415201 1 BBa_K415201 B0015 : T5-cmt (Terminator : T5-cmt Promoter) 2010-08-19T11:00:00Z 2015-05-08T01:12:27Z This part comes from BioBricks BBa_B0015 and BBa_K415200. This is a terminator followed by a copy of the cmt operator downstream of a partial T5 promoter. This part is an intermediate part that will could be used in order to ensure leaky expression from components preceding the T5-cmt promoter does not interfere with the activity of the T5-cmt promoter or any subsequent parts. This composite part consists of BioBricks BBa_K415200 and BBa_B0015. true false _525_ 0 6719 9 Discontinued false No design considerations. false Grant Robinson component2078430 1 BBa_B0010 component2078438 1 BBa_K415200 component2078432 1 BBa_B0012 annotation2078438 1 BBa_K415200 range2078438 1 138 222 annotation2078430 1 BBa_B0010 range2078430 1 1 80 annotation2078432 1 BBa_B0012 range2078432 1 89 129 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K415200_sequence 1 aaatcataaaaaatttatttgctttgtgagcggataacaattataatagattcaacaaacagacaatctggtctgtttgtattat BBa_K415201_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagaaatcataaaaaatttatttgctttgtgagcggataacaattataatagattcaacaaacagacaatctggtctgtttgtattat BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z