BBa_K415202 1 BBa_K415202 cymR Repressor Protein 2010-08-19T11:00:00Z 2015-05-08T01:12:27Z CymR was derived from the organism Pseudomonas Putida. The copy of cymR used in the construction of BBa_K415202 was generously donated by Noah Davidsohn. The cymR repressor tightly and efficiently binds the cmt operator. In conjunction with part BBa_K415200, this repressor may be used to create an inverter or similar logical circuitry. cymR changes conformation upon induction with cumate (isopropylbenozate), and may be used in a manner similar to the lacI/IPTG system. The cymR repressor appears to bind the complementary cmt operator more efficiently than lac repressor binds the lac operator, according to Choi, et al. in a recent (as of 2010) paper titled, "A novel, versatile, and tightly regulated expression system for E. Coli strains." true false _525_ 0 6719 9 Discontinued false This repressor required site-directed mutagenesis of nucleotide 132 to a G in order to remove a PstI cut site. false Grant Robinson BBa_K415202_sequence 1 atgagtccaaagagaagaacacaggcagagcgcgcaatggagacccagggcaagttgattgcagcggccctgggggttttacgggaaaaaggttacgcgggattccggatcgcagatgtgcccggtgctgcgggtgtctcgagaggagcgcagagccatcatttcccgacaaagcttgagcttctgcttgccacttttgaatggctttacgaacagatcaccgaacgcagtcgggctcgattagcgaaattgaagccagaggatgacgtcatccagcaaatgctggacgacgccgccgaatttttcctcgacgatgacttctctatcagccttgatttgattgtggctgccgaccgggatccagcgttacgcgagggtattcagcgcacggtagagaggaatcggtttgtcgtcgaggatatgtggcttggtgttctggtgagccgtggtctttcgcgtgatgatgcagaagatatcctttggttgatattcaattcggtgcgtgggcttgctgttcgtagcctatggcagaaggacaaagaacgctttgagcgtgtcaggaactcgacactcgaaattgcgcgagagcggtacgcgaaattcaagcgctag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z