BBa_K415202 1 BBa_K415202 cymR Repressor Protein 2010-08-19T11:00:00Z 2015-05-08T01:12:27Z CymR was derived from the organism Pseudomonas Putida. The copy of cymR used in the construction of BBa_K415202 was generously donated by Noah Davidsohn. The cymR repressor tightly and efficiently binds the cmt operator. In conjunction with part BBa_K415200, this repressor may be used to create an inverter or similar logical circuitry. cymR changes conformation upon induction with cumate (isopropylbenozate), and may be used in a manner similar to the lacI/IPTG system. The cymR repressor appears to bind the complementary cmt operator more efficiently than lac repressor binds the lac operator, according to Choi, et al. in a recent (as of 2010) paper titled, "A novel, versatile, and tightly regulated expression system for E. Coli strains." true false _525_ 0 6719 9 Discontinued false This repressor required site-directed mutagenesis of nucleotide 132 to a G in order to remove a PstI cut site. false Grant Robinson BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K415204 1 BBa_K415204 B0034 : cymR Repressor Protein (Strong cymR Translational Unit) 2010-08-19T11:00:00Z 2015-05-08T01:12:27Z This part consists of BioBricks BBa_B0034, a strong RBS, and BBa_K415202, the cymR repressor. This is a translational unit consisting of a strong RBS and the cymR repressor protein; cymR binds tightly and efficiently to the cmt operator, but changes conformation and detaches from DNA when it forms a complex with cumate (isopropybenozate). This part allows for strong translation of mature RNA containing the cymR coding sequence. true false _525_ 0 6719 9 Discontinued false No design considerations to note. false Grant Robinson component2078444 1 BBa_K415202 component2078443 1 BBa_B0034 annotation2078443 1 BBa_B0034 range2078443 1 1 12 annotation2078444 1 BBa_K415202 range2078444 1 19 630 BBa_K415202_sequence 1 atgagtccaaagagaagaacacaggcagagcgcgcaatggagacccagggcaagttgattgcagcggccctgggggttttacgggaaaaaggttacgcgggattccggatcgcagatgtgcccggtgctgcgggtgtctcgagaggagcgcagagccatcatttcccgacaaagcttgagcttctgcttgccacttttgaatggctttacgaacagatcaccgaacgcagtcgggctcgattagcgaaattgaagccagaggatgacgtcatccagcaaatgctggacgacgccgccgaatttttcctcgacgatgacttctctatcagccttgatttgattgtggctgccgaccgggatccagcgttacgcgagggtattcagcgcacggtagagaggaatcggtttgtcgtcgaggatatgtggcttggtgttctggtgagccgtggtctttcgcgtgatgatgcagaagatatcctttggttgatattcaattcggtgcgtgggcttgctgttcgtagcctatggcagaaggacaaagaacgctttgagcgtgtcaggaactcgacactcgaaattgcgcgagagcggtacgcgaaattcaagcgctag BBa_B0034_sequence 1 aaagaggagaaa BBa_K415204_sequence 1 aaagaggagaaatactagatgagtccaaagagaagaacacaggcagagcgcgcaatggagacccagggcaagttgattgcagcggccctgggggttttacgggaaaaaggttacgcgggattccggatcgcagatgtgcccggtgctgcgggtgtctcgagaggagcgcagagccatcatttcccgacaaagcttgagcttctgcttgccacttttgaatggctttacgaacagatcaccgaacgcagtcgggctcgattagcgaaattgaagccagaggatgacgtcatccagcaaatgctggacgacgccgccgaatttttcctcgacgatgacttctctatcagccttgatttgattgtggctgccgaccgggatccagcgttacgcgagggtattcagcgcacggtagagaggaatcggtttgtcgtcgaggatatgtggcttggtgttctggtgagccgtggtctttcgcgtgatgatgcagaagatatcctttggttgatattcaattcggtgcgtgggcttgctgttcgtagcctatggcagaaggacaaagaacgctttgagcgtgtcaggaactcgacactcgaaattgcgcgagagcggtacgcgaaattcaagcgctag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z