BBa_K415205 1 BBa_K415205 J23117 : B0031 : cymR Repressor Protein [Weak cymR Generator] 2010-08-19T11:00:00Z 2015-05-08T01:12:27Z This part consists of BioBricks BBa_J23117 and BBa_K415203. This is a copy of a moderately expressed cymR repressor under the control of a weak, constitutive promoter. This is a modular component for circuit construction and a weak cymR generator. true false _525_ 0 6719 9 Discontinued false Note that a weak promoter was chosen in order to follow the construction design of Choi, et al. in the 2010 paper, "A novel, versatile, and tightly regulated expression system for E. Coli strains." Previous work by Choi and others in M. Extorquens indicated that overexpression of cymR was potentially toxic to bacterial cells; although data concerning this toxicity is unavailable, the researchers managed to develop a tightly expressed cymR switch by placing cymR under the control of a weak, constitutive promoter for kanamycin resistance. As our team was unable to clarify the origin of this sequence, we instead selected a weak, constitutive promoter from the Anderson library. false Grant Robinson component2078447 1 BBa_B0031 component2078448 1 BBa_K415202 component2078445 1 BBa_J23117 annotation2078447 1 BBa_B0031 range2078447 1 44 57 annotation2078445 1 BBa_J23117 range2078445 1 1 35 annotation2078448 1 BBa_K415202 range2078448 1 64 675 BBa_K415202 1 BBa_K415202 cymR Repressor Protein 2010-08-19T11:00:00Z 2015-05-08T01:12:27Z CymR was derived from the organism Pseudomonas Putida. The copy of cymR used in the construction of BBa_K415202 was generously donated by Noah Davidsohn. The cymR repressor tightly and efficiently binds the cmt operator. In conjunction with part BBa_K415200, this repressor may be used to create an inverter or similar logical circuitry. cymR changes conformation upon induction with cumate (isopropylbenozate), and may be used in a manner similar to the lacI/IPTG system. The cymR repressor appears to bind the complementary cmt operator more efficiently than lac repressor binds the lac operator, according to Choi, et al. in a recent (as of 2010) paper titled, "A novel, versatile, and tightly regulated expression system for E. Coli strains." true false _525_ 0 6719 9 Discontinued false This repressor required site-directed mutagenesis of nucleotide 132 to a G in order to remove a PstI cut site. false Grant Robinson BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_J23117 1 BBa_J23117 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K415202_sequence 1 atgagtccaaagagaagaacacaggcagagcgcgcaatggagacccagggcaagttgattgcagcggccctgggggttttacgggaaaaaggttacgcgggattccggatcgcagatgtgcccggtgctgcgggtgtctcgagaggagcgcagagccatcatttcccgacaaagcttgagcttctgcttgccacttttgaatggctttacgaacagatcaccgaacgcagtcgggctcgattagcgaaattgaagccagaggatgacgtcatccagcaaatgctggacgacgccgccgaatttttcctcgacgatgacttctctatcagccttgatttgattgtggctgccgaccgggatccagcgttacgcgagggtattcagcgcacggtagagaggaatcggtttgtcgtcgaggatatgtggcttggtgttctggtgagccgtggtctttcgcgtgatgatgcagaagatatcctttggttgatattcaattcggtgcgtgggcttgctgttcgtagcctatggcagaaggacaaagaacgctttgagcgtgtcaggaactcgacactcgaaattgcgcgagagcggtacgcgaaattcaagcgctag BBa_J23117_sequence 1 ttgacagctagctcagtcctagggattgtgctagc BBa_B0031_sequence 1 tcacacaggaaacc BBa_K415205_sequence 1 ttgacagctagctcagtcctagggattgtgctagctactagagtcacacaggaaacctactagatgagtccaaagagaagaacacaggcagagcgcgcaatggagacccagggcaagttgattgcagcggccctgggggttttacgggaaaaaggttacgcgggattccggatcgcagatgtgcccggtgctgcgggtgtctcgagaggagcgcagagccatcatttcccgacaaagcttgagcttctgcttgccacttttgaatggctttacgaacagatcaccgaacgcagtcgggctcgattagcgaaattgaagccagaggatgacgtcatccagcaaatgctggacgacgccgccgaatttttcctcgacgatgacttctctatcagccttgatttgattgtggctgccgaccgggatccagcgttacgcgagggtattcagcgcacggtagagaggaatcggtttgtcgtcgaggatatgtggcttggtgttctggtgagccgtggtctttcgcgtgatgatgcagaagatatcctttggttgatattcaattcggtgcgtgggcttgctgttcgtagcctatggcagaaggacaaagaacgctttgagcgtgtcaggaactcgacactcgaaattgcgcgagagcggtacgcgaaattcaagcgctag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z