BBa_K415200 1 BBa_K415200 Strong Constitutive T5 Promoter with cmt Operator (T5-cmt) 2010-08-19T11:00:00Z 2015-05-08T01:12:27Z This part was synthesized via minigene construction by Mr. Gene; its source is the 2010 paper by Choi, et al., titled, "A novel, versatile, and tightly regulated expression system for E. Coli strains." This is a strong, constitutive partial T5 promoter with the cmt operator appended immediately afterward. This construct was specified in a recent (as of 2010) paper by Choi, et al., titled, "A novel, versatile, and tightly regulated expression system for E. Coli strains." In the absence of cymR, this promoter should function as a strong, constitutive promoter; in the presence of cymR, this promoter should be repressed with essentially zero leaky transcription. true false _525_ 0 6719 9 Discontinued false This promoter contains the T5 partial promoter, the sequence of which was derived from the 2010 Choi, et al. paper. Like T7 bacteriophage promoters, this T5 promoter is constitutive and strong; unlike T7 promoters, however, it does not require T7 RNA Polymerase. This means that the T5 promoter could have wide applicability as a strong promoter in Escherichia coli and other organisms. false Grant Robinson annotation2078428 1 cmt Operator range2078428 1 54 85 annotation2078429 1 T5 Partial Promoter range2078429 1 1 53 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K415205 1 BBa_K415205 J23117 : B0031 : cymR Repressor Protein [Weak cymR Generator] 2010-08-19T11:00:00Z 2015-05-08T01:12:27Z This part consists of BioBricks BBa_J23117 and BBa_K415203. This is a copy of a moderately expressed cymR repressor under the control of a weak, constitutive promoter. This is a modular component for circuit construction and a weak cymR generator. true false _525_ 0 6719 9 Discontinued false Note that a weak promoter was chosen in order to follow the construction design of Choi, et al. in the 2010 paper, "A novel, versatile, and tightly regulated expression system for E. Coli strains." Previous work by Choi and others in M. Extorquens indicated that overexpression of cymR was potentially toxic to bacterial cells; although data concerning this toxicity is unavailable, the researchers managed to develop a tightly expressed cymR switch by placing cymR under the control of a weak, constitutive promoter for kanamycin resistance. As our team was unable to clarify the origin of this sequence, we instead selected a weak, constitutive promoter from the Anderson library. false Grant Robinson component2078448 1 BBa_K415202 component2078447 1 BBa_B0031 component2078445 1 BBa_J23117 annotation2078445 1 BBa_J23117 range2078445 1 1 35 annotation2078447 1 BBa_B0031 range2078447 1 44 57 annotation2078448 1 BBa_K415202 range2078448 1 64 675 BBa_K415210 1 BBa_K415210 Temporary cymR Stochastic Trigger 2010-12-15T12:00:00Z 2015-05-08T01:12:27Z TBD TBD false false _525_ 0 6719 9 Not in stock false TBD false Grant Robinson component2115115 1 BBa_K415201 component2115105 1 BBa_K415205 annotation2115105 1 BBa_K415205 range2115105 1 1 675 annotation2115115 1 BBa_K415201 range2115115 1 684 905 BBa_K415201 1 BBa_K415201 B0015 : T5-cmt (Terminator : T5-cmt Promoter) 2010-08-19T11:00:00Z 2015-05-08T01:12:27Z This part comes from BioBricks BBa_B0015 and BBa_K415200. This is a terminator followed by a copy of the cmt operator downstream of a partial T5 promoter. This part is an intermediate part that will could be used in order to ensure leaky expression from components preceding the T5-cmt promoter does not interfere with the activity of the T5-cmt promoter or any subsequent parts. This composite part consists of BioBricks BBa_K415200 and BBa_B0015. true false _525_ 0 6719 9 Discontinued false No design considerations. false Grant Robinson component2078430 1 BBa_B0010 component2078438 1 BBa_K415200 component2078432 1 BBa_B0012 annotation2078430 1 BBa_B0010 range2078430 1 1 80 annotation2078438 1 BBa_K415200 range2078438 1 138 222 annotation2078432 1 BBa_B0012 range2078432 1 89 129 BBa_K415202 1 BBa_K415202 cymR Repressor Protein 2010-08-19T11:00:00Z 2015-05-08T01:12:27Z CymR was derived from the organism Pseudomonas Putida. The copy of cymR used in the construction of BBa_K415202 was generously donated by Noah Davidsohn. The cymR repressor tightly and efficiently binds the cmt operator. In conjunction with part BBa_K415200, this repressor may be used to create an inverter or similar logical circuitry. cymR changes conformation upon induction with cumate (isopropylbenozate), and may be used in a manner similar to the lacI/IPTG system. The cymR repressor appears to bind the complementary cmt operator more efficiently than lac repressor binds the lac operator, according to Choi, et al. in a recent (as of 2010) paper titled, "A novel, versatile, and tightly regulated expression system for E. Coli strains." true false _525_ 0 6719 9 Discontinued false This repressor required site-directed mutagenesis of nucleotide 132 to a G in order to remove a PstI cut site. false Grant Robinson BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_J23117 1 BBa_J23117 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K415202_sequence 1 atgagtccaaagagaagaacacaggcagagcgcgcaatggagacccagggcaagttgattgcagcggccctgggggttttacgggaaaaaggttacgcgggattccggatcgcagatgtgcccggtgctgcgggtgtctcgagaggagcgcagagccatcatttcccgacaaagcttgagcttctgcttgccacttttgaatggctttacgaacagatcaccgaacgcagtcgggctcgattagcgaaattgaagccagaggatgacgtcatccagcaaatgctggacgacgccgccgaatttttcctcgacgatgacttctctatcagccttgatttgattgtggctgccgaccgggatccagcgttacgcgagggtattcagcgcacggtagagaggaatcggtttgtcgtcgaggatatgtggcttggtgttctggtgagccgtggtctttcgcgtgatgatgcagaagatatcctttggttgatattcaattcggtgcgtgggcttgctgttcgtagcctatggcagaaggacaaagaacgctttgagcgtgtcaggaactcgacactcgaaattgcgcgagagcggtacgcgaaattcaagcgctag BBa_J23117_sequence 1 ttgacagctagctcagtcctagggattgtgctagc BBa_K415210_sequence 1 ttgacagctagctcagtcctagggattgtgctagctactagagtcacacaggaaacctactagatgagtccaaagagaagaacacaggcagagcgcgcaatggagacccagggcaagttgattgcagcggccctgggggttttacgggaaaaaggttacgcgggattccggatcgcagatgtgcccggtgctgcgggtgtctcgagaggagcgcagagccatcatttcccgacaaagcttgagcttctgcttgccacttttgaatggctttacgaacagatcaccgaacgcagtcgggctcgattagcgaaattgaagccagaggatgacgtcatccagcaaatgctggacgacgccgccgaatttttcctcgacgatgacttctctatcagccttgatttgattgtggctgccgaccgggatccagcgttacgcgagggtattcagcgcacggtagagaggaatcggtttgtcgtcgaggatatgtggcttggtgttctggtgagccgtggtctttcgcgtgatgatgcagaagatatcctttggttgatattcaattcggtgcgtgggcttgctgttcgtagcctatggcagaaggacaaagaacgctttgagcgtgtcaggaactcgacactcgaaattgcgcgagagcggtacgcgaaattcaagcgctagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagaaatcataaaaaatttatttgctttgtgagcggataacaattataatagattcaacaaacagacaatctggtctgtttgtattat BBa_K415200_sequence 1 aaatcataaaaaatttatttgctttgtgagcggataacaattataatagattcaacaaacagacaatctggtctgtttgtattat BBa_K415201_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagaaatcataaaaaatttatttgctttgtgagcggataacaattataatagattcaacaaacagacaatctggtctgtttgtattat BBa_B0031_sequence 1 tcacacaggaaacc BBa_K415205_sequence 1 ttgacagctagctcagtcctagggattgtgctagctactagagtcacacaggaaacctactagatgagtccaaagagaagaacacaggcagagcgcgcaatggagacccagggcaagttgattgcagcggccctgggggttttacgggaaaaaggttacgcgggattccggatcgcagatgtgcccggtgctgcgggtgtctcgagaggagcgcagagccatcatttcccgacaaagcttgagcttctgcttgccacttttgaatggctttacgaacagatcaccgaacgcagtcgggctcgattagcgaaattgaagccagaggatgacgtcatccagcaaatgctggacgacgccgccgaatttttcctcgacgatgacttctctatcagccttgatttgattgtggctgccgaccgggatccagcgttacgcgagggtattcagcgcacggtagagaggaatcggtttgtcgtcgaggatatgtggcttggtgttctggtgagccgtggtctttcgcgtgatgatgcagaagatatcctttggttgatattcaattcggtgcgtgggcttgctgttcgtagcctatggcagaaggacaaagaacgctttgagcgtgtcaggaactcgacactcgaaattgcgcgagagcggtacgcgaaattcaagcgctag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z