BBa_K415510 1 SRE pSRE/CRE2_SV40 L4R1 Mammoblock 2010-10-26T11:00:00Z 2015-05-08T01:12:27Z We used primers containing the 37bp SRE/CRE2 element to add the sequence in front of an SV40 constitutive promoter via PCR. We cut the PCR product with PacI and BsrgI and ligated it into a cut L4R1 Mammoblock Promtoer Entry Vector. SRE/CRE2 is a hybrid promoter, constructed by placing elements from the mechanosensitive FosB promoter in front of an SV40 constitutive promoter. It's been shown that ERK-dependent activation of CREB binding to a CRE/AP-1 like element (designated ???CRE2???) in the FosB promoter is one of the main effectors of mechanosensitivity; SRE, or Shear Responsive Element, is a common stress-responsive element, first shown to mediate mechanosensation of the c-fos promtoter during angiogenesis. false false _525_ 0 6768 9 It's complicated true We wanted to avoid cloning the entire FosB promoter; our goal here was to isolate the regions that specifically controlled mechanosensitivity. This SRE/CRE2 element had previously been shown in the literature to control the responsiveness of osteoblasts to shear stress, and to confer mechanosensitivity when concatenated in front of the SV40 promoter and transfected into mammalian cells. We used the shortest sequence found in the literature to still control the pressure-sensing response. false Joy Jiao, Laura Deming, Adrian Slusarczyk annotation2109481 1 SV40 Const. Promoter range2109481 1 94 296 annotation2109480 1 CRE2 Element range2109480 1 66 72 annotation2109479 1 SRE Element range2109479 1 51 60 BBa_K415510_sequence 1 gctccgaattcggacagcagagatccagtttggttaattaatggcgagctccttatatggctaattgcgtcacaggaatcgagatctgcgatctgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagcttcgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z