BBa_K416001 1 BBa_K416001 (Gly4Ser)3 Flexible Peptide Linker 2010-05-28T11:00:00Z 2015-05-08T01:12:27Z The DNA came from K.D. Wittrup's lab at MIT, on the pCTCON plasmid used for yeast scFv surface display. This is a 15 amino acid flexible peptide linker protein domain that is useful for creating functional fusion proteins. The linker is to be fused in frame in between two protein domains, separating the two domains so that they each retain original functions yet will be physically connected. false false _527_ 0 6459 9 It's complicated false This sequence is meant to be translated between two different protein domains, so no start or stop codon is present. false Harris Kaplan BBa_K416001_sequence 1 ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z