BBa_K416003 1 BBa_K416003 Yeast Secretion Tag 2010-06-22T11:00:00Z 2015-05-08T01:12:27Z This part was sent to use from Dr. Sheldon Park of the University of Buffalo. This secretion tag when linked to the N-terminal of the protein directs extracellular secretion of the protein. After targeting through the ER to the golgi, this "pre-pro" tag is cleaved by the KEX-2 protease resulting in secretion of protein without the aforementioned tag. To use this tag, attached it directly upstream of your proteins CDS. false false _527_ 0 7430 9 It's complicated true There was an illegal Xbal1 site at bp 101 and we removed it through altering the primers necessary for biobricking the sequence. false John Phair BBa_K416003_sequence 1 atgaaagttttgattgttttgttggctattttcgctgctttgccattggctttggctcaaccagttatttctactactgttggttctgctgctgaaggttcactagataaaaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z