BBa_K416004 1 BBa_K416004 Aga2:(Gly3Ser)4 Linker Composite Part 2010-07-18T11:00:00Z 2015-05-08T01:12:27Z This part comes from the Aga2 [K416000] and Linker [K416001] parts we constructed this year. This composite part consists of the Aga2 yeast surface display CDS linked to a flexible (Glycine3Ser)4 linker. It can be used by linking it upstream of the protein you wish to be displayed on the surface of the yeast cell. Note: Aga1 must be constitutively expressed by the yeast strain for Aga2 to anchor to the cellular surface. false false _527_ 0 6443 9 It's complicated false This composite part was put together following RFC23, thus the scar between parts consists of the sequence ACTAGA false Russell Durrett component2074507 1 BBa_K416000 component2074508 1 BBa_K416001 annotation2074507 1 BBa_K416000 range2074507 1 1 261 annotation2074508 1 BBa_K416001 range2074508 1 270 314 BBa_K416000 1 BBa_K416000 Aga2 CDS Responsible for Yeast Surface Display 2010-05-27T11:00:00Z 2015-05-08T01:12:27Z This parts was biobricked from the pCTCON2 plasmid which was sent to us by Dr. D. K. Wittrup at MIT. The Aga2 protein is fused in frame with a protein that the user wants to display on the yeast cellular surface. Yeast cells constitutively expressing Aga1 (strain EBY100) secrete the Aga2 fusion protein, which associates with Aga1 through two disulfide bonds and quaternary structure to anchor Aga2 to the surface. The fused protein then is displayed on the surface of the yeast cell. The STOP codon at the end of the CDS was removed to allow for N- and C-terminus fusions. false false _527_ 0 6443 9 Not in stock true We removed the STOP codon to allow for N- and C-terminal fusions, which have both been proven to occur efficiently. false Russell Durrett annotation2069499 1 Aga2 CDS range2069499 1 1 261 BBa_K416001 1 BBa_K416001 (Gly4Ser)3 Flexible Peptide Linker 2010-05-28T11:00:00Z 2015-05-08T01:12:27Z The DNA came from K.D. Wittrup's lab at MIT, on the pCTCON plasmid used for yeast scFv surface display. This is a 15 amino acid flexible peptide linker protein domain that is useful for creating functional fusion proteins. The linker is to be fused in frame in between two protein domains, separating the two domains so that they each retain original functions yet will be physically connected. false false _527_ 0 6459 9 It's complicated false This sequence is meant to be translated between two different protein domains, so no start or stop codon is present. false Harris Kaplan BBa_K416004_sequence 1 atgcagttacttcgctgtttttcaatattttctgttattgcttcagttttagcacaggaactgacaactatatgcgagcaaatcccctcaccaactttagaatcgacgccgtactctttgtcaacgactactattttggccaacgggaaggcaatgcaaggagtttttgaatattacaaatcagtaacgtttgtcagtaattgcggttctcacccctcaacaactagcaaaggcagccccataaacacacagtatgttttttactagagggtggaggaggctctggtggaggcggtagcggaggcggagggtcg BBa_K416000_sequence 1 atgcagttacttcgctgtttttcaatattttctgttattgcttcagttttagcacaggaactgacaactatatgcgagcaaatcccctcaccaactttagaatcgacgccgtactctttgtcaacgactactattttggccaacgggaaggcaatgcaaggagtttttgaatattacaaatcagtaacgtttgtcagtaattgcggttctcacccctcaacaactagcaaaggcagccccataaacacacagtatgttttt BBa_K416001_sequence 1 ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z