BBa_K165002 1 BBa_K165002 Kozak sequence (yeast RBS) 2008-10-25T11:00:00Z 2015-05-08T01:10:55Z - Released HQ 2013 The kozak sequence acts as a eukaryotic RBS. It is cloned directly between a promoter and coding region. false false _267_ 0 2512 58 In stock false - false John Szymanski BBa_K165011 1 BBa_K165011 Zif268-HIV binding sites (3) 2008-10-25T11:00:00Z 2015-05-08T01:10:55Z - - false false _267_ 0 2512 58 It's complicated false - false John Szymanski BBa_K165031 1 BBa_K165031 mCYC promoter plus LexA binding sites 2008-10-28T12:00:00Z 2015-05-08T01:10:56Z Composite part was taken via PCR from a synthetic plasmid containing the sequence. The plasmid came from Lawrence Berkeley National Laboratory. This is a composite part containing the minimal promoter mCYC preceded by multiple consecutive binding sites for the LexA binding domain. false false _267_ 0 2510 58 It's complicated false It was necessary to design primers for use in PCR to remove this part from its host plasmid and transfer it to a standard Biobrick vector false Aaron Glieberman BBa_K416007 1 BBa_K416007 LexO:pCYC:RBS 2010-10-14T11:00:00Z 2015-05-08T01:12:27Z This part comes from parts sourced from the 2010 initial distribution This composite part consists of the Zif268 operator : the Lex operator : the pCYC minimal promoter and a Ribosome Binding Sequence (Kozak sequence). false false _527_ 0 6443 9 Not in stock false In our project, this part was used for the Lex operator immediately upstream of the CYC minimal promoter. We fused the RBS onto the part and submitted it to the Registry so future researchers would not have to fuse the RBS for future constructs. false Russell Durrett component2086425 1 BBa_K165011 component2086427 1 BBa_K165002 component2086426 1 BBa_K165031 annotation2086425 1 BBa_K165011 range2086425 1 1 46 annotation2086426 1 BBa_K165031 range2086426 1 55 457 annotation2086427 1 BBa_K165002 range2086427 1 466 483 BBa_K165002_sequence 1 cccgccgccaccatggag BBa_K165031_sequence 1 ctgtatataaaaccagtggttatatgtacagactagactgtatataaaaccagtggttatatgtacagactagactgtatataaaaccagtggttatatgtacagactagactgtatataaaaccagtggttatatgtacagactagactcgagcagatccgccaggcgtgtatatatagcgtggatggccaggcaactttagtgctgacacatacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttctatagacacacaaacacaaatacacacactaaattaataactag BBa_K165011_sequence 1 ctcgagcgatgctgcatcgatgctgcatcgatgctgcattctcgag BBa_K416007_sequence 1 ctcgagcgatgctgcatcgatgctgcatcgatgctgcattctcgagtactagagctgtatataaaaccagtggttatatgtacagactagactgtatataaaaccagtggttatatgtacagactagactgtatataaaaccagtggttatatgtacagactagactgtatataaaaccagtggttatatgtacagactagactcgagcagatccgccaggcgtgtatatatagcgtggatggccaggcaactttagtgctgacacatacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgcagcataaattactatacttctatagacacacaaacacaaatacacacactaaattaataactagtactagagcccgccgccaccatggag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z