BBa_K422005 1 BBa_K422005 CheR (AarI A-part) 2010-10-24T11:00:00Z 2015-05-08T01:12:28Z ''Escherichia coli'' genome The chemotactic network consists of membrane (methyl accepting chemotaxis proteins: MCPs) and intracellular proteins (Che) as signal transducers and receptors. MCPs sense a minimal difference in input concentration and transduce this information unit to the repsective proteins CheW and CheA, which located inside the cell. The autophosphorylation of CheA mediated by the MCPs is the key step in tumbling induction in response to increased repellent or decreased attractant concentration. The methylation state of the MCPs is influenced by the methyltransferase CheR (transfers a methylgroup to a protein) and the demethylase CheB (cleaves a methyl group off a protein). CheA phosphorylates CheY which then diffuses through the cytoplasm to the flagellar motor protein FliM which as a response induces tumbling. The phosphatase CheZ regulates the signal termination via dephosphorylation of CheYp (the p stands for the phosphorylated form of CheY). false false _533_ 0 7389 9 It's complicated false BBF RFC28: A method for combinatorial multi-part assembly based on the Type IIs restriction enzyme AarI. CheR-A is an A-part compatible for N-Terminal fusion. For more information see [1]. false Katharina Zwicky annotation2097751 1 AarI C-terminal overhang range2097751 1 878 881 annotation2097752 1 CheR A-part range2097752 1 16 877 annotation2097750 1 AarI N-terminal overhang range2097750 1 12 15 BBa_K422005_sequence 1 cacctgcaaaaggagatgacttcatctctgccctgtgggcaaacgtctttattgttacagatgaccgagcgcctggcgctttccgacgcgcattttcggcggataagtcaattgatctatcaacgagccgggatcgttctggctgaccataaacgcgacatggtttacaaccgactggttcgtcgtttgcgttcgctgggactgacggatttcggtcattatctgaacttgctggaatctaatcagcacagcggtgagtggcaggcgtttatcaattcgctgaccacgaatctgacggcatttttccgtgaggcacatcatttccctctgctcgcggatcacgcacgtcgccgttctggcgagtatcgcgtatggagcgcggcggcttcgaccggcgaagagccgtacagcattgcgatgacgctggctgacacattgggcaccgcgcccggacgctggaaagtgtttgccagtgatatcgacaccgaagtgctggaaaaagccagaagcggtatctatcgccatgaagagttgaaaaacctgacgccgcagcaactgcaacggtatttcatgcgagggacggggccgcatgaagggctggtacgcgtgcgtcaggagctggcgaactatgttgattttgccccgctgaatctactggcgaaacagtacaccgtgccggggccgtttgatgcgatcttctgtcgtaacgtcatgatctacttcgatcaaactacccagcaggagattttgcgccgctttgttccgctccttaaacccgacggattgctgtttgcgggtcactctgaaaactttagccaccttgagcgccgcttcacgctgcgtggtcagacggtgtatgcgctaagtaaggattccctttttgcaggtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z