BBa_K424002 1 BBa_K424002 LuxC gene from V. fischeri for generating light. 2010-06-06T11:00:00Z 2015-05-08T01:12:28Z NCIB ACCESSION Y00509 REGION: 1624..1866 The luxC gene sequence from "V. fischeri luxR, luxI and luxC genes". This will generate light using the standard e coli metabolites. It does not require the addtion of any substrate. true false _545_ 0 6272 9 Discontinued false We had difficulty combining this part with BBa_ak4q343 due to XXXX. false Patrick Nee annotation2070293 1 start range2070293 1 14 19 annotation2070292 1 Stop Codon range2070292 1 244 249 annotation2070294 1 light range2070294 1 22 234 BBa_K424002_sequence 1 ataggttcgtcgccgattatattcttcacttttccatcgttgaccaacggtatataaaaaattcacaatctgatttaaatttagattaattctatctttgatatttaatgtttttgaaactgaactttcagtaatgacagataattttactctattatcattatttagtttaacttctttatatgcataattatcaaaatcttgaatcattccattaattatcattggaatacatttattcattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z