BBa_K424002 1 BBa_K424002 LuxC gene from V. fischeri for generating light. 2010-06-06T11:00:00Z 2015-05-08T01:12:28Z NCIB ACCESSION Y00509 REGION: 1624..1866 The luxC gene sequence from "V. fischeri luxR, luxI and luxC genes". This will generate light using the standard e coli metabolites. It does not require the addtion of any substrate. true false _545_ 0 6272 9 Discontinued false We had difficulty combining this part with BBa_ak4q343 due to XXXX. false Patrick Nee annotation2070293 1 start range2070293 1 14 19 annotation2070292 1 Stop Codon range2070292 1 244 249 annotation2070294 1 light range2070294 1 22 234 BBa_K424003 1 BBa_K424003 luxC for light production protein generator 2010-06-06T11:00:00Z 2015-05-08T01:12:28Z Uses part <partinfo>BBa_K424002</partinfo> What does the device do? Helps to produce light What are the inputs and outputs to the device? Takes in a long-chain aldehyde + CoA + NADP(+) and produces a long-chain acyl-CoA + NADPH. Are any other devices needed? Also requires the other genes of the bacterial luciferase pathway. Does the device have any chassis dependencies? true false _545_ 0 6272 9 Discontinued false This device uses a strong RBS to drive translation of luxC. false Patrick Nee component2070296 1 BBa_B0030 component2070301 1 BBa_K424002 annotation2070296 1 BBa_B0030 range2070296 1 1 15 annotation2070301 1 BBa_K424002 range2070301 1 24 272 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_K424003_sequence 1 attaaagaggagaaatactagagataggttcgtcgccgattatattcttcacttttccatcgttgaccaacggtatataaaaaattcacaatctgatttaaatttagattaattctatctttgatatttaatgtttttgaaactgaactttcagtaatgacagataattttactctattatcattatttagtttaacttctttatatgcataattatcaaaatcttgaatcattccattaattatcattggaatacatttattcattaataa BBa_B0030_sequence 1 attaaagaggagaaa BBa_K424002_sequence 1 ataggttcgtcgccgattatattcttcacttttccatcgttgaccaacggtatataaaaaattcacaatctgatttaaatttagattaattctatctttgatatttaatgtttttgaaactgaactttcagtaatgacagataattttactctattatcattatttagtttaacttctttatatgcataattatcaaaatcttgaatcattccattaattatcattggaatacatttattcattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z