BBa_K426001 1 BBa_K426001 piggieBac_5'TR 2010-10-25T11:00:00Z 2015-05-08T01:12:28Z Synthetic This part encodes a DNA cis element. DNA cis elements are sequences that are bound by DNA binding domains, replication proteins, or DNA modification enzymes. The proteins sometimes just stick to them, and other times they perform some sort of DNA chemistry on them. This part is associated with piggyBac transposon devices. piggyBac transposase is a popular enzymes that generates protein-DNA complexes called transposomes from DNAs flanked by "terminal repeats". These terminal repeats, or TR's, are specific cis elements. The transposomes are highly reactive and insert the DNA contained within them randomly into other DNAs (such as a genome). false false _541_ 0 7241 9 It's complicated false Don't use Gibson synthesis because of the terminal repeats false Daniela Mehech BBa_K426001_sequence 1 gatctttaaccctagaaagatagtctgcgtaaaattgacgcatgcattcttgaaatattgctctctctttctaaatagcgcgaatccgtcgctgtgcatttaggacatctcagtcgccgcttggagctcccgtgaggcgtgcttgtcaatgcggtaagtgtcactgattttgaactataacgaccgcgtgagtcaaaatgacgcatgattatcttttacgtgacttttaagatttaactcatacgataattatattgttatttcatgttctacttacgtgataacttattatatatatattttcttgttatagatatcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z