BBa_K426007 1 BBa_K426007 zf- 2010-10-25T11:00:00Z 2015-05-08T01:12:29Z Synthetic This part encodes a DNA binding domain. DNA binding domains are proteins that bind to a specific DNA sequences. In the context of this project, they will be fused to other coding domains to generate chimeric enzymes that hopefully perform useful behavior that is somehow the sum of the two activities from which it is composed. Different DNA binding domain parts are needed in different flavors, so take special note of what type this one should be. This part is associated with Zinc Finger Nuclease devices. A zinc finger nuclease is an engineered protein derived from two zinc finger DNA binding proteins and cutting domains usually from a type IIS restriciton enzyme. The special thing about them is that 1) they bind long sequences of DNA, long enough that it might be unique in a eukaryotic genome, and 2) zinc finger proteins that bind to most sequences can be generated somewhat easily. So, you can use a zinc finger nuclease to introduce a ds break at a specific user-defined site in a eukaryotic genome if the protein is delivered to the nucleus of the cell. Eukaryotic ds breaks stimulate homologous recombination. So, if you deliver both the ZFN and a DNA homologous to the target site, you get insertion of your DNA into that site of the genome. false false _541_ 0 7241 9 It's complicated false NA false Daniela Mehech BBa_K426007_sequence 1 gatctgcacctaagaagaaacgcaaagtgggtatccatggagtaccagcagcaatggccgaacgtccattccagtgtcgtatttgcatgcgaaatttctcccgctctgataacctgtctgttcacatccgaacgcacactggcgaaaagccgttcgcttgcgacatttgtggacgtaagtttgcccgtaacgctcaccggatcaaccatacgaagatccacactggtagtcaaaaacctttccaatgccggatctgcatgcggaattttagccgtagtgacaccctcagcgaacatattcgcactcacacaggagaaaagcctttcgcgtgtgatatctgcggacgaaagttcgcagctcgatcaacccgtaccaaccacacaaaaattcacctccgtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z