BBa_K426012 1 BBa_K426012 FokI Cleavage Domain (fok+) 2010-10-25T11:00:00Z 2015-05-08T01:12:29Z Synthetic A similar part exists in the Registry of standard biological parts, but this part sequence differs by 1 mutation and 3 extra AA at N-term. This part encodes a DNA modifying enzyme. This part is associated with Zinc Finger Nuclease devices. A zinc finger nuclease is an engineered protein derived from two zinc finger DNA binding proteins and cutting domains usually from a type IIS restriciton enzyme. The special thing about them is that 1) they bind long sequences of DNA, long enough that it might be unique in a eukaryotic genome, and 2) zinc finger proteins that bind to most sequences can be generated somewhat easily. So, you can use a zinc finger nuclease to introduce a ds break at a specific user-defined site in a eukaryotic genome if the protein is delivered to the nucleus of the cell. Eukaryotic ds breaks stimulate homologous recombination. So, if you deliver both the ZFN and a DNA homologous to the target site, you get insertion of your DNA into that site of the genome. false false _541_ 0 7241 9 It's complicated false NA false Daniela Mehech BBa_K426012_sequence 1 gatctcagctggttaaatctgaactggaggagaaaaaatccgagctgcgccacaaactgaaatatgtgcctcacgagtatatcgaactgatcgagatcgcccgtaatagtacccaagaccgtatcctggaaatgaaagtgatggagttcttcatgaaagtctatggctatcgtggcaaacatctgggtggtagccgtaaacctgatggtgccatttataccgttggttccccgatcgattatggcgttatcgttgataccaaagcctatagcgggggttataacctgccaattggtcaggctgatgagatgcagcgttatgtgaaagagaaccagactcgtaacaaacacatcaacccgaacgaatggtggaaagtgtatccgtcaagcgttacagagttcaaattcctgttcgtgagcggccattttaaaggcaactataaagcacagctgacccgtctgaaccataaaaccaattgcaatggcgccgttctgtcagtagaagagctgctgattggcggtgaaatgatcaaagccgggaccctgacactggaagaagttcgccgtaaattcaacaatggggagatcaatttttaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z