BBa_K427000 1 pBad Weak PBad Weak Reverse 2010-10-18T11:00:00Z 2015-05-08T01:12:29Z It was synthesized from the sequence created by British Columbia team in 2009 PBad Weak Rev is the reverse complement of the Arabinose inducible promoter created by British Columbia in 2009. It is a mutation of the wild type PBad promoter that increases the amount of arabinose needed to induce the transcription of the downstream sequences. false false _544_ 0 6605 9 It's complicated false We only had to create the reverse complement of the sequence that was already on the registry false Tatiana J. N????ez Elizondo annotation2090357 1 PBad Weak Reverse range2090357 1 1 130 BBa_K427000_sequence 1 gctagcccaaaaaaacggtatggagaaacagtagagagttgcgataaaaagcgtcaggtaggatccgctaatcttatggataaaaaagctatggcatagcaaagtgtgacgccgtgcaaataatcaatgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z