BBa_K427001 1 BBa_K427001 C protein of the Mu bacteriophage 2010-10-21T11:00:00Z 2015-05-08T01:12:29Z Synthetized from the reported sequence of C protein from Mu bacteriophage. It was optimized for its expression in E. coli. C is a protein of the Mu bacteriophage. It is typically transcribed by the middle promoter of the phage (Pm) and it activates the four late promoters Plys, Pi, Pp and Pmom. Since it is the activator of the late it can be used alongside them to build a sensitivity tuner that increases the POPS output of a construct. The part includes the ribosome binding site, so it can be used directly after a promoter in a genetic construct. false false _544_ 0 6602 9 It's complicated false The sequence was optimized for its production on E. coli and the ribosome binding site was added at the beginning of the sequence. false Jan Marte Contreras Ortiz annotation2092370 1 MuC range2092370 1 18 438 annotation2092369 1 RBS range2092369 1 1 12 BBa_K427001_sequence 1 aaagaggagaaatactagatgcaacatgacctgtttgagcatgatccggcgattcgtcagctgattggccatatcgacaacattccggcacctgaactggaaagtcgctggcctcgtagcgtggttgatctgatcgatgttctggagaacgaactgaaacgccaaaatgtgtctaacccacgtgagctggctcgtaaacaagcagttgccctgtcttgcttcctgggtggacgtcaattctatatcccgtgtggcgacacgatcctgacagcactgcgtgatgatctgctgtattgccagtttaatggccgtaacatggaagaactgcgccgtcaatatcgtctgtctcagccacagatttatcaaatcattgctcgccagcgtaaactgcatacacgtcgccatcaacctgacctgttctctccggaaacaccgaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z