BBa_K427002 1 BBa_K427002 Mor protein of Mu bacteriophage 2010-10-21T11:00:00Z 2015-05-08T01:12:29Z Synthetized from the reported sequence of Mor protein from Mu bacteriophage. It was optimized for its expression in E. coli. Mor is a protein of the Mu bacteriophage. It is typically transcribed by the early promoter of the phage and it activates the middle promoter Pm. Since it is the activator of Pm it can be used alongside this promoter to build a sensitivity tuner that increases the POPS output of a construct. The part includes the ribosome binding site, so it can be used directly after a promoter in a genetic construct. false false _544_ 0 6602 9 It's complicated false We did an E. coli codon optimization of the sequence and added a ribosome binding site to the sequence before synthesis. false Jan Marte Contreras Ortiz annotation2092364 1 RBS range2092364 1 1 12 annotation2092366 1 MuMor range2092366 1 19 405 BBa_K427002_sequence 1 aaagaggagaaatactagatgactgaagacctgtttggtgatctgcaagacgataccattctggcacacctggataatcctgccgaggacacaagccgttttccggcgctgctggctgaactgaacgatctgctgcgtggtgagctgtctcgcctgggagttgaccctgcccattctctggagattgtcgtggccatttgtaaacatctgggcggaggccaagtttatattccacgtggacaggcactggacagtctgattcgtgacctgcgcatttggaacgatttcaacgggcgtaatgtgagtgaactgactacccgctatggagtgacttttaacaccgtgtataaagccattcgccgtatgcgtcgtctgaaatatcgccagtatcaaccgagcctgctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z