BBa_K427003 1 BBa_K427003 Pm promoter of Mu bacteriophage 2010-10-21T11:00:00Z 2015-05-08T01:12:29Z Synthetized from the reported sequence of Pm promoter from Mu bacteriophage. Pm is the middle promoter of the Mu bacteriophage. It is in charge of the transcription of the activator protein C. Pm is activated by a product of the early transcription, protein Mor. It can be used to build a sensitivity tuner alongside this protein, this construct can be used to increase the amount of POPS in a certain genetic construction. false false _544_ 0 6602 9 It's complicated false No special considerations false Jan Marte Contreras Ortiz annotation2092367 1 Pm range2092367 1 1 71 BBa_K427003_sequence 1 ttctgtaaacagtaaagccggttaatccggctttttttacgtcctcaatatcctgtgatgaataaccgtac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z