BBa_K427004 1 BBa_K427004 Pmom promoter of Mu bacteriophage 2010-10-21T11:00:00Z 2015-05-08T01:12:29Z Synthetized from the reported sequence of Pmom promoter from Mu bacteriophage Pmom is one of the four late promoters of the Mu bacteriophage. It can be activated by the C protein, which is produced by the middle promoter Pm. Pmom works because of a special configuration of the DNA. It can be used to create a sensitivity tuner alongside the C protein of the same phage. This construction can be used to increase the POPS output of a promoter. false false _544_ 0 6602 9 It's complicated false The design of this part had no special considerations false Jan Marte Contreras Ortiz annotation2092368 1 Pmom range2092368 1 1 79 BBa_K427004_sequence 1 ggtaatacagatcgattatgccccaataaccacactcaacccatgatgttttttaagatagtggcgaattgatgcaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z