BBa_K427005 1 BBa_K427005 MuC sensitivity tuner (PoPS->PoPS) 2010-10-21T11:00:00Z 2015-05-08T01:12:29Z We built this part form C and Pmom sequences of Mu bacetriophage and included the bidirectional terminator BBa_B0014 from the registry. This is a sensitivity tuner created form the C protein and Pmom promoter of the Mu bacteriophage it can be used to increase the PoPS of a construct. The C protein encoded in the first part of the construct is the activator of the Pmom promoter, which does not begin transcription until the C protein binds to its consensus sequence and attracts the polymerase. false false _544_ 0 6602 9 It's complicated true No special design considerations false Jan Marte Contreras Ortiz component2092382 1 BBa_B0014 component2092384 1 BBa_K427004 component2092375 1 BBa_K427001 annotation2092375 1 BBa_K427001 range2092375 1 1 438 annotation2092382 1 BBa_B0014 range2092382 1 447 541 annotation2092384 1 BBa_K427004 range2092384 1 550 628 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_K427001 1 BBa_K427001 C protein of the Mu bacteriophage 2010-10-21T11:00:00Z 2015-05-08T01:12:29Z Synthetized from the reported sequence of C protein from Mu bacteriophage. It was optimized for its expression in E. coli. C is a protein of the Mu bacteriophage. It is typically transcribed by the middle promoter of the phage (Pm) and it activates the four late promoters Plys, Pi, Pp and Pmom. Since it is the activator of the late it can be used alongside them to build a sensitivity tuner that increases the POPS output of a construct. The part includes the ribosome binding site, so it can be used directly after a promoter in a genetic construct. false false _544_ 0 6602 9 It's complicated false The sequence was optimized for its production on E. coli and the ribosome binding site was added at the beginning of the sequence. false Jan Marte Contreras Ortiz annotation2092370 1 MuC range2092370 1 18 438 annotation2092369 1 RBS range2092369 1 1 12 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K427004 1 BBa_K427004 Pmom promoter of Mu bacteriophage 2010-10-21T11:00:00Z 2015-05-08T01:12:29Z Synthetized from the reported sequence of Pmom promoter from Mu bacteriophage Pmom is one of the four late promoters of the Mu bacteriophage. It can be activated by the C protein, which is produced by the middle promoter Pm. Pmom works because of a special configuration of the DNA. It can be used to create a sensitivity tuner alongside the C protein of the same phage. This construction can be used to increase the POPS output of a promoter. false false _544_ 0 6602 9 It's complicated false The design of this part had no special considerations false Jan Marte Contreras Ortiz annotation2092368 1 Pmom range2092368 1 1 79 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939311 1 BBa_B0011 component939303 1 BBa_B0012 annotation939303 1 BBa_B0012 range939303 1 1 41 annotation939311 1 BBa_B0011 range939311 1 50 95 BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K427004_sequence 1 ggtaatacagatcgattatgccccaataaccacactcaacccatgatgttttttaagatagtggcgaattgatgcaaag BBa_K427005_sequence 1 aaagaggagaaatactagatgcaacatgacctgtttgagcatgatccggcgattcgtcagctgattggccatatcgacaacattccggcacctgaactggaaagtcgctggcctcgtagcgtggttgatctgatcgatgttctggagaacgaactgaaacgccaaaatgtgtctaacccacgtgagctggctcgtaaacaagcagttgccctgtcttgcttcctgggtggacgtcaattctatatcccgtgtggcgacacgatcctgacagcactgcgtgatgatctgctgtattgccagtttaatggccgtaacatggaagaactgcgccgtcaatatcgtctgtctcagccacagatttatcaaatcattgctcgccagcgtaaactgcatacacgtcgccatcaacctgacctgttctctccggaaacaccgaaatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattttactagagggtaatacagatcgattatgccccaataaccacactcaacccatgatgttttttaagatagtggcgaattgatgcaaag BBa_K427001_sequence 1 aaagaggagaaatactagatgcaacatgacctgtttgagcatgatccggcgattcgtcagctgattggccatatcgacaacattccggcacctgaactggaaagtcgctggcctcgtagcgtggttgatctgatcgatgttctggagaacgaactgaaacgccaaaatgtgtctaacccacgtgagctggctcgtaaacaagcagttgccctgtcttgcttcctgggtggacgtcaattctatatcccgtgtggcgacacgatcctgacagcactgcgtgatgatctgctgtattgccagtttaatggccgtaacatggaagaactgcgccgtcaatatcgtctgtctcagccacagatttatcaaatcattgctcgccagcgtaaactgcatacacgtcgccatcaacctgacctgttctctccggaaacaccgaaa BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z