BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939311 1 BBa_B0011 component939303 1 BBa_B0012 annotation939311 1 BBa_B0011 range939311 1 50 95 annotation939303 1 BBa_B0012 range939303 1 1 41 BBa_K427002 1 BBa_K427002 Mor protein of Mu bacteriophage 2010-10-21T11:00:00Z 2015-05-08T01:12:29Z Synthetized from the reported sequence of Mor protein from Mu bacteriophage. It was optimized for its expression in E. coli. Mor is a protein of the Mu bacteriophage. It is typically transcribed by the early promoter of the phage and it activates the middle promoter Pm. Since it is the activator of Pm it can be used alongside this promoter to build a sensitivity tuner that increases the POPS output of a construct. The part includes the ribosome binding site, so it can be used directly after a promoter in a genetic construct. false false _544_ 0 6602 9 It's complicated false We did an E. coli codon optimization of the sequence and added a ribosome binding site to the sequence before synthesis. false Jan Marte Contreras Ortiz annotation2092366 1 MuMor range2092366 1 19 405 annotation2092364 1 RBS range2092364 1 1 12 BBa_K427003 1 BBa_K427003 Pm promoter of Mu bacteriophage 2010-10-21T11:00:00Z 2015-05-08T01:12:29Z Synthetized from the reported sequence of Pm promoter from Mu bacteriophage. Pm is the middle promoter of the Mu bacteriophage. It is in charge of the transcription of the activator protein C. Pm is activated by a product of the early transcription, protein Mor. It can be used to build a sensitivity tuner alongside this protein, this construct can be used to increase the amount of POPS in a certain genetic construction. false false _544_ 0 6602 9 It's complicated false No special considerations false Jan Marte Contreras Ortiz annotation2092367 1 Pm range2092367 1 1 71 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_K427006 1 BBa_K427006 MuMor Sensitivity tuner (PoPS->PoPS) 2010-10-21T11:00:00Z 2015-05-08T01:12:29Z We built this part form Mor and Pm sequences of Mu bacetriophage and included the bidirectional terminator BBa_B0014 from the registry. This is a sensitivity tuner created form the Mor protein and Pm promoter of the Mu bacteriophage it can be used to increase the PoPS of a construct. The Mor protein encoded in the first part of the construct is the activator of the Pm promoter, which does not begin transcription until the Mor protein binds to its consensus sequence and attracts the polymerase. false false _544_ 0 6602 9 It's complicated true No special design considerations false Jan Marte Contreras Ortiz component2092424 1 BBa_K427002 component2092433 1 BBa_K427003 component2092431 1 BBa_B0014 annotation2092431 1 BBa_B0014 range2092431 1 414 508 annotation2092433 1 BBa_K427003 range2092433 1 517 587 annotation2092424 1 BBa_K427002 range2092424 1 1 405 BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K427006_sequence 1 aaagaggagaaatactagatgactgaagacctgtttggtgatctgcaagacgataccattctggcacacctggataatcctgccgaggacacaagccgttttccggcgctgctggctgaactgaacgatctgctgcgtggtgagctgtctcgcctgggagttgaccctgcccattctctggagattgtcgtggccatttgtaaacatctgggcggaggccaagtttatattccacgtggacaggcactggacagtctgattcgtgacctgcgcatttggaacgatttcaacgggcgtaatgtgagtgaactgactacccgctatggagtgacttttaacaccgtgtataaagccattcgccgtatgcgtcgtctgaaatatcgccagtatcaaccgagcctgctgtactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattttactagagttctgtaaacagtaaagccggttaatccggctttttttacgtcctcaatatcctgtgatgaataaccgtac BBa_K427002_sequence 1 aaagaggagaaatactagatgactgaagacctgtttggtgatctgcaagacgataccattctggcacacctggataatcctgccgaggacacaagccgttttccggcgctgctggctgaactgaacgatctgctgcgtggtgagctgtctcgcctgggagttgaccctgcccattctctggagattgtcgtggccatttgtaaacatctgggcggaggccaagtttatattccacgtggacaggcactggacagtctgattcgtgacctgcgcatttggaacgatttcaacgggcgtaatgtgagtgaactgactacccgctatggagtgacttttaacaccgtgtataaagccattcgccgtatgcgtcgtctgaaatatcgccagtatcaaccgagcctgctg BBa_K427003_sequence 1 ttctgtaaacagtaaagccggttaatccggctttttttacgtcctcaatatcctgtgatgaataaccgtac BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z