BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_K206001 1 BBa_K206001 pBAD weak 2009-10-16T11:00:00Z 2015-05-08T01:11:23Z Site-directed mutagenesis on <partinfo>I13453</partinfo> with the following primers: Forward: TAATCTTATGGATAAAAAAGCTATGGCATAGC Reverse: GCGGATCCTACCTGACGCTTTTTATC Released HQ 2013 Weaker version of wild type pBAD (<partinfo>I13453</partinfo>). false false _307_ 0 4172 9 In stock true No special considerations false Amelia Hardjasa annotation2049255 1 promoter range2049255 1 1 131 annotation2049256 1 AraI1 range2049256 1 40 57 annotation2049257 1 AraI2 range2049257 1 61 78 BBa_K427008 1 BBa_K427008 Ter PBadweak Mu Mor Ter PM GFP cassette 2010-10-21T11:00:00Z 2015-05-08T01:12:29Z Biobricks This part was used for the characterization of the MuMor sensitivity tuner. It is composed of seven biobricks starting with Ter PBadweak, which is the part created by British Columbia team in 2007 starts with a terminator and a promoter that respond to high concentrations of Arabinose. It is followed by sequence coding for Mor protein which inter activates the Pm promoter and this enhance the PoPS activity. Then is followed by the GFP cassette sequence a biobrick. false false _544_ 0 6605 9 It's complicated true - false Tatiana J. N????ez Elizondo component2092787 1 BBa_B0014 component2092804 1 BBa_K427006 component2092791 1 BBa_K206001 component2092815 1 BBa_E0840 annotation2092804 1 BBa_K427006 range2092804 1 242 828 annotation2092815 1 BBa_E0840 range2092815 1 837 1714 annotation2092787 1 BBa_B0014 range2092787 1 1 95 annotation2092791 1 BBa_K206001 range2092791 1 104 233 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939311 1 BBa_B0011 component939303 1 BBa_B0012 annotation939311 1 BBa_B0011 range939311 1 50 95 annotation939303 1 BBa_B0012 range939303 1 1 41 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K427003 1 BBa_K427003 Pm promoter of Mu bacteriophage 2010-10-21T11:00:00Z 2015-05-08T01:12:29Z Synthetized from the reported sequence of Pm promoter from Mu bacteriophage. Pm is the middle promoter of the Mu bacteriophage. It is in charge of the transcription of the activator protein C. Pm is activated by a product of the early transcription, protein Mor. It can be used to build a sensitivity tuner alongside this protein, this construct can be used to increase the amount of POPS in a certain genetic construction. false false _544_ 0 6602 9 It's complicated false No special considerations false Jan Marte Contreras Ortiz annotation2092367 1 Pm range2092367 1 1 71 BBa_K427002 1 BBa_K427002 Mor protein of Mu bacteriophage 2010-10-21T11:00:00Z 2015-05-08T01:12:29Z Synthetized from the reported sequence of Mor protein from Mu bacteriophage. It was optimized for its expression in E. coli. Mor is a protein of the Mu bacteriophage. It is typically transcribed by the early promoter of the phage and it activates the middle promoter Pm. Since it is the activator of Pm it can be used alongside this promoter to build a sensitivity tuner that increases the POPS output of a construct. The part includes the ribosome binding site, so it can be used directly after a promoter in a genetic construct. false false _544_ 0 6602 9 It's complicated false We did an E. coli codon optimization of the sequence and added a ribosome binding site to the sequence before synthesis. false Jan Marte Contreras Ortiz annotation2092364 1 RBS range2092364 1 1 12 annotation2092366 1 MuMor range2092366 1 19 405 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_E0840 1 GFP genera GFP generator 2004-10-17T11:00:00Z 2015-08-31T04:07:26Z Released HQ 2013 B0030.E0040.B0015 false true _11_1_ 0 61 7 In stock true true Jennifer Braff component1249242 1 BBa_E0040 component1249257 1 BBa_B0012 component1249247 1 BBa_B0010 component1249239 1 BBa_B0030 annotation1249247 1 BBa_B0010 range1249247 1 750 829 annotation1249257 1 BBa_B0012 range1249257 1 838 878 annotation1249242 1 BBa_E0040 range1249242 1 22 741 annotation1249239 1 BBa_B0030 range1249239 1 1 15 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K427006 1 BBa_K427006 MuMor Sensitivity tuner (PoPS->PoPS) 2010-10-21T11:00:00Z 2015-05-08T01:12:29Z We built this part form Mor and Pm sequences of Mu bacetriophage and included the bidirectional terminator BBa_B0014 from the registry. This is a sensitivity tuner created form the Mor protein and Pm promoter of the Mu bacteriophage it can be used to increase the PoPS of a construct. The Mor protein encoded in the first part of the construct is the activator of the Pm promoter, which does not begin transcription until the Mor protein binds to its consensus sequence and attracts the polymerase. false false _544_ 0 6602 9 It's complicated true No special design considerations false Jan Marte Contreras Ortiz component2092433 1 BBa_K427003 component2092431 1 BBa_B0014 component2092424 1 BBa_K427002 annotation2092431 1 BBa_B0014 range2092431 1 414 508 annotation2092433 1 BBa_K427003 range2092433 1 517 587 annotation2092424 1 BBa_K427002 range2092424 1 1 405 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K427008_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattttactagagacattgattatttgcacggcgtcacactttgctatgccatagcttttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagagaaagaggagaaatactagatgactgaagacctgtttggtgatctgcaagacgataccattctggcacacctggataatcctgccgaggacacaagccgttttccggcgctgctggctgaactgaacgatctgctgcgtggtgagctgtctcgcctgggagttgaccctgcccattctctggagattgtcgtggccatttgtaaacatctgggcggaggccaagtttatattccacgtggacaggcactggacagtctgattcgtgacctgcgcatttggaacgatttcaacgggcgtaatgtgagtgaactgactacccgctatggagtgacttttaacaccgtgtataaagccattcgccgtatgcgtcgtctgaaatatcgccagtatcaaccgagcctgctgtactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattttactagagttctgtaaacagtaaagccggttaatccggctttttttacgtcctcaatatcctgtgatgaataaccgtactactagagattaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K427006_sequence 1 aaagaggagaaatactagatgactgaagacctgtttggtgatctgcaagacgataccattctggcacacctggataatcctgccgaggacacaagccgttttccggcgctgctggctgaactgaacgatctgctgcgtggtgagctgtctcgcctgggagttgaccctgcccattctctggagattgtcgtggccatttgtaaacatctgggcggaggccaagtttatattccacgtggacaggcactggacagtctgattcgtgacctgcgcatttggaacgatttcaacgggcgtaatgtgagtgaactgactacccgctatggagtgacttttaacaccgtgtataaagccattcgccgtatgcgtcgtctgaaatatcgccagtatcaaccgagcctgctgtactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattttactagagttctgtaaacagtaaagccggttaatccggctttttttacgtcctcaatatcctgtgatgaataaccgtac BBa_K206001_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcttttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_B0030_sequence 1 attaaagaggagaaa BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_E0840_sequence 1 attaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K427002_sequence 1 aaagaggagaaatactagatgactgaagacctgtttggtgatctgcaagacgataccattctggcacacctggataatcctgccgaggacacaagccgttttccggcgctgctggctgaactgaacgatctgctgcgtggtgagctgtctcgcctgggagttgaccctgcccattctctggagattgtcgtggccatttgtaaacatctgggcggaggccaagtttatattccacgtggacaggcactggacagtctgattcgtgacctgcgcatttggaacgatttcaacgggcgtaatgtgagtgaactgactacccgctatggagtgacttttaacaccgtgtataaagccattcgccgtatgcgtcgtctgaaatatcgccagtatcaaccgagcctgctg BBa_K427003_sequence 1 ttctgtaaacagtaaagccggttaatccggctttttttacgtcctcaatatcctgtgatgaataaccgtac BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z