BBa_K431009 1 BBa_K431009 glyceraldehyde 3-phosphate dehydrogenase promoter (pGAP) 2010-09-20T11:00:00Z 2015-05-08T01:12:29Z This part came from the genome of ''P. pastoris'' This promoter is responsible for the transcription of glyceraldehyde 3-phosphate dehydrogenase in ''Pichia pastoris''. Because this is a key enzyme for glycolysis, it is a strong constitutive promoter. This promoter is one of the most common alternatives to pAOX1 for heterologous protein production in ''P. pastoris''. It is advantageous because its use obviates the hazards and expenses involved with using methanol and still provides high yields of protein. false false _570_ 0 6820 9 Not in stock false The following primers were used to isolate a 0.9kb segment known to contain the pGAP regulatory activity Forward:5'GCTCTAGGCAGCGAGCTGATCCTTTTTTGTAT Reverse:5'GGCCACTAGTTGTGTTTTGATAGTTGTTC false David Joseph Sexton Jr. annotation2080602 1 pGAP range2080602 1 1 493 BBa_K431009_sequence 1 ggatccttttttgtagaaatgtcttggtgtcctcgtccaatcaggtagccatctctgaaatatctggctccgttgcaactccgaacgacctgctggcaacgtaaaattctccggggtaaaacttaaatgtggagtaatggaaccagaaacgtctcttcccttctctctccttccaccgcccgttaccgtccctaggaaattttactctgctggagagcttcttctacggcccccttgcagcaatgctcttcccagcattacgttgcgggtaaaacggaagtcgtgtacccgacctagcagcccagggatggaaaagtcccggccgtcgctggcaataatagcgggcggacgcatgtcatgagattattggaaaccaccagaatcgaatataaaaggcgaacacctttcccaattttggtttctcctgacccaaagactttaaatttaatttatttgtccctatttcaatcaattgaacaactatcaaaacaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z