BBa_K432000 1 BBa_K432000 Circadian rhythm plant gene promoter 2010-06-02T11:00:00Z 2015-05-08T01:12:29Z This promoter is derived from genomic sequence upstream of the CAB2 gene of Arabidopsis thaliana. It has previously been shown to direct the expression of genes during the early morning in plants. TTTATATTAATGTTTCGATCATCAGAATCTATATTTTCAAAATGTTATACTTTAAGTTTTAGTTATTGGGTTGTAGCAAAAATCATTCTTGTCACGAGGGTGTAAGTAAGTGTAACCGTTGAAGTATTCAGTGGCTCATAACTTGTGGTCACAAAACGCTTGGCTGCAATGAAAAAATCAAAACAAATGCTGGTGGACTAGAGATTGCCACGTAAGACTACTAAACGATAAAACAAAAATCTTAAAATCCAATGAATGAACAGATAAAGATTACTTCAGATATAACAAACGTTACAATATCCCTATATAATCCAACACTATCGAACCAGTTTTAAT false false _571_ 0 3772 9 No part sequence false We have not made any changes to the sequence, there are no illegal restriction sites found in this promoter. false Ryan Lee igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z