BBa_K496002 1 BBa_K496002 Reverse primer for visualizing restriction enzyme digestion. 2010-08-24T11:00:00Z 2015-05-08T01:12:29Z Restriction enzyme digestion cut offs must be big enough to view under UV light. When 2 restriction enzymes are used prefix and suffix cut offs must be distinguishable. Tried to make primer sites universal for every plasmid. Used for amplifying BioBricks. When plasmid with BioBrick is amplified generates 100bp BioBrick prefix tail (prefix included), and 200bp BioBrick suffix tail (suffix included). So when restriction enzyme digestion is performed correctly this should leave traceable band when electrophoresis is performed. Also DNA cut offs are of different sizes to visualize which end is digested. This primer set makes amplified BioBricks 300bp longer making small parts like RBS easier to extract from gel. And even when small BioBrick is single enzyme digested it is still longer than 100bp or 200bp accordingly. This primer set is currently experimental. Should work with pSB1A3 pSB1A7 pSB1AC3 pSB1AK3 pSB1AT3 pSB1C3 pSB1K3 pSB1T3 Does not work with, because one of the primers site is missing. pSB2K3 false false _575_ 0 6855 9 Not in stock true Designed after pSB1C3 pSB1A3 pSB1T3 plasmid universal primer sites. false Laurynas VANAGAS BBa_K496002_sequence 1 tcccctgattctgtggataaccgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z