BBa_K496003 1 BBa_K496003 RBS + SlrP secretion tag, salmonella T3 sec. sys. 2010-10-16T11:00:00Z 2015-05-08T01:12:29Z This parts source is from genomic sequence of Salmonella enterica subsp. enterica serovar Typhimurium str. LT2. Amplified b y PCR. leucine-rich repeat protein (SlrP) One of the secretion signals in Salmonella Type 3 Secretion System(T3SS). In theory can be used to secrete tagged proteins through Type 3 Secretion Apparatus(T3SA). Due to functional restrictions of T3SA it's known that it can't transport very stable proteins like zinc fingers. Regardless it was shown to transport such stable proteins like GFP. Currently this part is in trials to see if it will secrete GFP. Chassis is E.coli with BAC vector fragment (SGSC4024 1464540-1562427) of salmonella SPI2. Please consult papers bellow about details A conserved amino acid sequence directing intracellular type III secretion by Salmonella typhimurium Edward A. Miao and Samuel I. Miller 2000 false false _575_ 0 6855 9 It's complicated true RBS was added by primer in the process of PCR. false Shunichi MAKINO annotation2117352 1 SlrP range2117352 1 15 587 annotation2117351 1 BBa_B0034 range2117351 1 1 12 BBa_K496003_sequence 1 aaagaggagaaaatatgtttaatattactaatatacaatctacggcaaggcatcaaagtattagcaatgaggcctcaacagaggtgcctttaaaagaagagatatggaataaaataagtgcctttttctcttcagaacatcaggttgaagcacaaaactgcatcgcttatctttgtcatccacctgaaaccgcctcgccagaagagatcaaaagcaagtttgaatgtttaaggatgttagctttcccggcgtatgcggataatattcagtatagtagaggaggggcagaccaatactgtattttgagtgaaaatagtcaggaaattctgtctatagtttttaatacagagggctataccgttgagggagggggaaagtcagtcacctatacccgtgtgacagaaagcgagcaggcgagtagcgcttccggctccaaagatgctgtgaattatgagttaatctggtctgagtgggtaaaagaggcgccagcgaaagaggcagcaaatcgtgaagaagccgtacaacggatgcgtgactgcctgaaaaataataagacggaacttcgtctgaaaatattaggacttacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z