BBa_K497014 1 BBa_K497014 Deinococcus radiodurans bacteriophytochrome fwd primer with RBS 2010-10-26T11:00:00Z 2015-05-08T01:12:29Z Deinococcus radiodurans This is the forward primer to amplify the full length bacteriophytochrome gene from D. radiodurans with an additional ribosome binding site inserted. false false _576_ 0 7723 9 Not in stock false tba false Joanna Hare BBa_K497014_sequence 1 aggagggctgctatgagccgggacccgttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z