BBa_K497019 1 BBa_K497019 Reverse primer Deinococcus radiodurans bacteriophytochrome gene for insertion after heme oxygenase 2010-10-26T11:00:00Z 2015-05-08T01:12:30Z Deinococcus radiodurans This is the reverse primer for full amplification of bacteriophytochrome gene of D. radiodurans. This has an additional sequence added so that the bacteriophytochrome gene can be inserted in an operon after a heme oxygeanase gene. false false _576_ 0 7723 9 Not in stock false tba false Joanna Hare BBa_K497019_sequence 1 gttagcagccggatcctcaggcatcggcggctcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z