BBa_K510022 1 BBa_K510022 attTn7 2011-09-18T11:00:00Z 2015-05-08T01:12:30Z The attTn7 was obtained from the purified genome of E. coli MC4100 by PCR (using a high accuracy Pfu polymerase) with these primers: gaattcgcggccgcttctagagTGCAGCTGCTGGCTTACCATG and ctgcagcggccgctactagtaACATGGAGTTGGCAGGATGTTTG. Released HQ 2013 TnsABC+D transposase machinery causes the site-specific insertion of the Tn7 transposon in the attTn7 (from attachment site) sequence, which is found in many bacteria. This insertion site is well conserved in Gram-negative bacteria, an even in higher organisms until humans. However, here we add a portable attTn7 to allow using the miniTn7 BioBrick toolkit in any organism as well as in plasmids. All the derivatives of the miniTn7 BioBrick toolkit could be inserted in the attTn7 site by transposition. false false _673_ 0 6163 9 In stock true The attTn7 site was flanked by prefix and suffix for cloning purposes. false David Caballero BBa_K510022_sequence 1 tgcagctgctggcttaccatgtcgcgctgatcaaaggcaccgacgttgaccagccgcgtaacctggcaaaatcggttacggttgagtaataaatggatgccctgcgtaagcggggcatttttcttcctgttatgtttttaatcaaacatcctgccaactccatgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z