BBa_K510030 1 BBa_K510030 T adh1-tetO2 2011-09-19T11:00:00Z 2015-05-08T01:12:30Z It is composed of two parts. The first one is the ADH1 terminator, which functions as an insulator or boundary for transcription isolation. The second one is formed by two tetR operator sequences (tetO2), of 19 nucleotides each one, alternated with spacers. This composite part should be inserted just in front of a promoter in order to control its regulations by generating a nucleated structure of heterochromatinic DNA, together with his associated part tetO4-terminator. Compaction of DNA is due to binding of engineered silencing proteins (tetR+heterochromatin forming protein)to tetO sequences. false false _673_ 0 6162 9 Not in stock false false Paola Gallardo, Rafael R. Daga annotation2135816 1 tetO range2135816 1 236 254 annotation2135645 1 tetO range2135645 1 278 296 annotation2135644 1 adh1 terminator range2135644 1 4 183 BBa_K510030_sequence 1 tccgcgaatttcttatgatttatgatttttattattaaataagttataaaaaaaataagtgtatacaaattttaaagtgactcttaggttttaaaacgaaaattcttattcttgagtaactctttcctgtaggtcaggttgctttctcaggtatagtatgaggtcgctcttattgaccacacctctaccggcagatccgctagggataacagggtaatatagatcaattcctcgatccctatcagtgatagagagtcgacaaagtcgagtttctcgatccctatcagtgatagagagtcgacaaagtcgagtttcttcgagga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z