BBa_K511001 1 BBa_K511001 minCMV-1xCI434 Promoter MammoBlock 2011-09-24T11:00:00Z 2015-05-08T01:12:31Z This promoter is a synthetic construct composed of the minimal sequence required for transcription from the immediate-early cytomegalovirus (CMV) promoter preceded by a binding site for the CI434 protein adapted from bacteriophage 434. This part encodes a promoter that is moderately inducible by the CI434-VP16 transactivator and constitutively off otherwise. As shown in Figures 1 and 2 below, induction with the CI434-VP16 transactivator results in marked increase in fluorescence from a construct containing a red fluorescent protein (mKate) driven by the minCMV-1xCI434 promoter. false false _674_ 0 6719 9 It's complicated false This particular promoter has a propensity to mutate in cells that are not exceptionally recombination-deficient, and caution should be taken in producing both entry and expression vectors using this part. false Grant Robinson annotation2139543 1 CI434 Box range2139543 1 1 46 annotation2139544 1 minCMV Promoter range2139544 1 56 113 BBa_K511001_sequence 1 ttgacaaacaagatacattgtatgaaaatacaagaaagtttgttgacgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z