BBa_K511003 1 BBa_K511003 UAS-Gal4 Promoter MammoBlock 2011-09-24T11:00:00Z 2015-05-08T01:12:31Z This part was synthesized to include the upstream activator sequence (UAS) from the Saccharomyces cerevisiae genome that binds to the Gal4 transactivator upstream of the major-late adenovirus promoter. This part encodes a promoter that is inducible by variants of the Gal4 transactivator and off otherwise. As shown in Figures 1 and 2, fluorescence from a red fluorescent protein (mKate) driven by the UAS-Gal4 promoter is very strong in the presence of constitutively produced Gal4 derivative with an attached viral VP16 transactivation domain (Gal4-VP16), and is essentially off in the absences of the Gal4-VP16 transactivator. false false _674_ 0 6719 9 It's complicated true Not applicable. false Grant Robinson annotation2139552 1 Gal4-Binding Region range2139552 1 46 148 annotation2139553 1 Major-Late Adenovirus Promoter range2139553 1 160 200 BBa_K511003_sequence 1 gctccgaattgggacagcagagatccagtttggttaattaatagacggagtactgtcctccgagcggagtactgtcctccgactcgagcggagtactgtcctccgatcggagtactgtcctccgcgaattccggagtactgtcctccgaagacgctagcggggggctataaaagggggtgggggcgttcgtcctcactctcaattcggcccaattcgacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z