BBa_K511004 1 BBa_K511004 TRE-Tight-LacOid Promoter MammoBlock 2011-09-27T11:00:00Z 2015-05-08T01:12:31Z This part is a synthetic promoter formed from the minimal transcriptional sequence necessary for the immediate-early cytomegalovirus (CMV) promoter, a LacOid operator that has been computationally shown to bind to the LacI repressor protein more tightly than the wildtype LacO operator, and six tetracycline response elements (TREs) isolated from Escherichia coli. This part encodes an inducible promoter that can be activated by tTA/rtTA transactivator variants in the presence of tetracycline analogues and can be repressed by variants of the LacI transcriptional repressor. false false _674_ 0 6719 9 It's complicated false Not applicable. false Grant Robinson annotation2145559 1 TRE-LacO Promoter range2145559 1 1 338 BBa_K511004_sequence 1 aattgtgagcgctcacaattgcaggtccgaggttctagacgagtttactccctatcagtgatagagaacgatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttatccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcaattgtgagcgctcacaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z